Post B5oyihIl59bdb6LxeC by vgarzareyna@mstdn.mx
(DIR) More posts by vgarzareyna@mstdn.mx
(DIR) Post #B5oyUKpZpZRPqrr5bE by johnefrancis@cosocial.ca
0 likes, 0 repeats
@molly0xfff sprinkle in some genetic sequences here and there. GAAATGCCCATACCCACATTT = 12
(DIR) Post #B5oyUL1z5RMkTLezwG by vgarzareyna@mstdn.mx
0 likes, 0 repeats
@johnefrancis @molly0xfff hehe cat
(DIR) Post #B5oyihIl59bdb6LxeC by vgarzareyna@mstdn.mx
0 likes, 0 repeats
@molly0xfff couldn't be me. as soon as any excel file I create reaches some complexity threshold (mostly vibes based, tbh) I start formatting everything. I usually also fill the cells with autocalculated values some shade of gray to know i shouldn't touch those:)) (i know i could just lock the cells, btw)
(DIR) Post #B5p08K0sOGUmqwltZ2 by vgarzareyna@mstdn.mx
0 likes, 0 repeats
@molly0xfff if I ever hack your google account i will format your spreadsheets, color-code the cells, give them descriptive names and add comments/labels to make sure other hackers can understand what you're calculating
(DIR) Post #B5pMMQKHugAFTiyr8y by foobarsoft@mastodon.social
0 likes, 1 repeats
@vgarzareyna @johnefrancis @molly0xfff That needs to be a bad sci-fi movie. It’s like the fly, only instead of mixing with a fly it’s a DNA sequence accidentally typed in by the person’s cat.
(DIR) Post #B5pMOkdPNV1N2j29wG by vgarzareyna@mstdn.mx
0 likes, 0 repeats
@foobarsoft @johnefrancis @molly0xfff i think you can just sell the idea to netflix and they'll make 8 1hr episodes out of it