Newsgroups: sci.bio
Path: utzoo!utgpu!news-server.csri.toronto.edu!rpi!zaphod.mps.ohio-state.edu!magnus.acs.ohio-state.edu!csn!boulder!boulder!eesnyder
From: eesnyder@boulder.Colorado.EDU (Eric E. Snyder)
Subject: Re: Reconstructing cells from DNA
Message-ID: <eesnyder.671376120@beagle>
Sender: news@colorado.edu (The Daily Planet)
Nntp-Posting-Host: beagle.colorado.edu
Organization: University of Colorado, Boulder
References: <18637@csli.Stanford.EDU>
Date: 11 Apr 91 13:22:00 GMT

cphoenix@csli.Stanford.EDU (Chris Phoenix) writes:

>I recently started speculating about non-genetic mutations in cells....

>I'm sure everyone's read about recreating dinosaurs by finding dinosaur DNA 
>in tar pits or ice and injecting it into a chicken embryo (or something like
>that).  My question is whether DNA really completely determines what a cell
>"grows up" to be.  

This is a small departure from you question but it is an interesting 
case of 'non-genetic' inheritance.

In most organisms, there are 'strict maternal effect' genes/mutations.
In these cases, the viability of the progeny is independent of the progeny's
genotype and determined by the genotype of the mother.  

Thus, a dinosaur will probably be in need of more than a few 'maternal 
effect gene-products' which the chicken egg into which it was injected
would be lacking.

---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder                            
Department of MCD Biology              ...making feet for childrens' shoes.
University of Colorado, Boulder   
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------
