[HN Gopher] Baby is healed with first personalized gene-editing ...
       ___________________________________________________________________
        
       Baby is healed with first personalized gene-editing treatment
        
       Author : jbredeche
       Score  : 1199 points
       Date   : 2025-05-15 18:06 UTC (2 days ago)
        
 (HTM) web link (www.nytimes.com)
 (TXT) w3m dump (www.nytimes.com)
        
       | jakubmazanec wrote:
       | https://archive.ph/VNYzA
        
       | chewbacha wrote:
       | Good thing RFK pushed out the official overseeing this financing
       | and the current administration is actively defunding the
       | organizations that produced this.
       | 
       | Better to have more disabled or dead babies instead of science.
       | 
       | /s
        
         | JumpCrisscross wrote:
         | Genuine question: is this research not being pursued in China?
        
           | sigzero wrote:
           | Yes, other countries are pursuing this.
        
           | mylons wrote:
           | it is.
        
           | kccqzy wrote:
           | A Chinese scientist claimed that he did CRISPR on twins back
           | in 2018. https://www.science.org/content/article/crispr-
           | bombshell-chi...
           | 
           | He was jailed for illegal medical practices but it seemed
           | like he established a proper lab after serving the sentence
           | and hopefully he is focused on less objectionable practices.
           | https://www.npr.org/2023/06/08/1178695152/china-scientist-
           | he...
        
         | pacoWebConsult wrote:
         | From a purely utilitarian perspective, funding research like
         | this is not an effective use of dollars at the margin. How many
         | people could we save if an equivalent amount was put into
         | reducing obesity, smoking, and drinking? How many people could
         | we save if we stopped spending money we don't have to do things
         | that the government isn't competent at allocating anyways?
         | 
         | That's not to say the research itself is not impressive nor
         | important, but think critically about the fact that this money
         | doesn't exist in a vacuum.
        
           | rco8786 wrote:
           | Given the admin's propensity for cutting spending on research
           | like this and other domestic interests while ratcheting up
           | military spending I think that poster's point stands.
        
           | casey2 wrote:
           | Somewhere between 0 and -100,000,000
        
           | tchalla wrote:
           | I'm glad we don't only think from a utilitarian perspective
           | then.
        
             | psychoslave wrote:
             | It's not even that. Utilitarian premises still let a very
             | broad set of perspective. A long term perspective on large
             | humanity won't lead to same conclusion as what will be the
             | most joy inducing experiences in the next 24h for the 1%
             | wealthiest people in the world right now.
        
           | benlivengood wrote:
           | All those wasted dollars and time put into the discovery of
           | the germ theory of disease instead of growing and
           | distributing food to the invalids.
        
           | wat10000 wrote:
           | How do you know it's not effective? The cost per life saved
           | is extremely high _now_ , but this stuff gets better over
           | time. How much did penicillin cost to produce originally?
        
             | inglor_cz wrote:
             | Early penicilin was rare enough that they collected the
             | urine of the first patients and re-extracted penicilin from
             | it for further use.
        
             | lukevp wrote:
             | Isn't penicillin just bread mold? So probably not a great
             | example.
        
               | wat10000 wrote:
               | And yet, the first patient treated with mass-produced
               | penicillin used half the total supply, and the stuff was
               | so rare that it was extracted from patients' urine for
               | reuse.
        
           | nonameiguess wrote:
           | > How many people could we save if an equivalent amount was
           | put into reducing obesity, smoking, and drinking?
           | 
           | How confident are you the answer isn't very close to zero?
           | We've already curtailed smoking quite a bit in the past 30
           | years. At the level of an individual, it isn't any particular
           | mystery how to stop obesity or to simply not drink, but
           | population-level interventions attempting to get people to
           | voluntarily behave differently for their own health
           | historically haven't worked well in these specific domains.
           | Throwing more money at the problem doesn't seem like it would
           | obviously change that.
           | 
           | Also keep in mind that overeating and alcohol addiction have
           | significant genetic components. Research into gene editing
           | has the eventual potential to cure damn near _any_ disease,
           | including whatever pet causes you personally think are worth
           | defeating.
        
             | sigzero wrote:
             | It is also capable of creating new diseases that will be
             | resistant to anything we currently have to fight with.
        
               | inglor_cz wrote:
               | You can torture and execute people with electricity, but
               | it does not follow that discovery and use of electricity
               | was, on the net, a wash.
        
             | psychoslave wrote:
             | >population-level interventions attempting to get people to
             | voluntarily behave differently for their own health
             | historically haven't worked well in these specific domains
             | 
             | Said like that it paints things like there are not far more
             | resources spent on propagating the bad habits (as some ROI
             | is expected from this by some actors), and any attempt to
             | put a social health program in history always ended in
             | major catastrophes.
        
           | vjvjvjvjghv wrote:
           | With that line of thinking you would never do any advanced
           | science.
        
           | inglor_cz wrote:
           | This argument could be used to stop absolutely any research
           | that isn't dirt cheap.
           | 
           | Maybe even the dirt cheap one, because even 100 dollars could
           | go longer way somewhere in the Sahel.
           | 
           | It is good that the humanity does _not_ have a one-track
           | mind.
        
             | jonhohle wrote:
             | I've thought about this recently as well and I don't know
             | if I have a fully developed view. What is the moral
             | responsibility of all people to pay for medical research or
             | operations that would affect a small number of people. Is
             | it ethical to compel others to pay for the research deemed
             | valuable by some, but not by others. Who is the arbiter of
             | that research's value?
             | 
             | I could say I believe the government should fund research
             | into fixing people who think cilantro tastes like soap
             | because for most of us it is delicious and promotes healthy
             | diets. Should I be able to compel (tax) you to pay for that
             | research?
             | 
             | Where that line is drawn will always be wrong to someone.
             | How research is prioritized will always be wrong to
             | someone. Is there an ethical way to determine the best use
             | of collective resources and what portion of one's property
             | must be taken from them to fund that research.
        
               | inglor_cz wrote:
               | I think that taxpayers should be advised that science is
               | not a straightforward process like building a house from
               | blueprints, and that a lot of important discoveries
               | happen serendipitously.
               | 
               | The cilantro taste stuff does not sound absurd to me at
               | all. In biology, there is no hard wall between banal
               | stuff and critical stuff; they interact and fundamentally
               | operate in the same environment under the same genetic
               | and epigenetic rules. Sure, the research necessary for
               | correcting cilantro-as-soap may be marginal, but there is
               | a chance of discovering something significant along the
               | way.
               | 
               | We should be more careful and also honest when
               | communicating about science to taxpayers.
        
           | jonplackett wrote:
           | I admit to having a similar thought to this - especially if
           | it is then going to be commercialised and sold for millions
           | of dollars per treatment.
           | 
           | BUT the long term view of creating a technology that can
           | treat any genetic illness (or maybe even any illness?) must
           | outweigh that _eventually_
        
           | rcpt wrote:
           | A huge amount of money went into researching anti obesity
           | medications
        
             | XorNot wrote:
             | Which it's worth noting, succeeded so wildly that 1/5th of
             | Denmark's jobs growth last year was related to Ozempic
             | production.
        
           | os2warpman wrote:
           | I think you may be operating under the assumption that the
           | extremely expensive price tag will need to be repeated for
           | each patient.
           | 
           | In reality, as this process becomes more mature it is going
           | to become inexpensive.
           | 
           | The reduction in cost will almost certainly be similar to
           | reduction in cost needed to sequence an individual's genome,
           | which has fallen from tens of millions to hundreds of
           | dollars.
           | 
           | The only catch is that we have to spend money to get there.
           | 
           | Another catch is that the nations who underwrite this
           | research will turn millions in investments into trillions in
           | dividends and the stingy or poor will be left in the cold.
           | 
           | Seeing that private enterprise is only good at taking
           | publicly-funded work and patenting it, and that in the
           | absence of public funding nothing ever gets invented, we
           | should be all-in on this.
           | 
           | edit: it's apropos that you mentioned obesity because GLP-1
           | drugs are the direct, irrefutable, product of spending at
           | government labs.
           | 
           | edit2: specifically, a single government scientist playing
           | around with lizard saliva in the 1970s because he thought it
           | was interesting.
        
             | WorkerBee28474 wrote:
             | > In reality, as this process becomes more mature it is
             | going to become inexpensive.
             | 
             | There's no evidence to support that gene therapy will ever
             | be inexpensive. We can merely say that the process may
             | become less shockingly expensive.
        
               | paulryanrogers wrote:
               | What should we as humanity, as society, spend most of our
               | wealth and resources doing?
               | 
               | Sending robber barrons and their girlfriends into space?
        
               | philipkglass wrote:
               | I'm of accord with the Utopians of Ada Palmer's _Too Like
               | the Lightning_ :
               | 
               |  _When a Utopian dies, of anything, the cause is marked
               | and not forgotten until solved. A fall? They rebuild the
               | site to make it safe. A criminal? They do not rest until
               | he is rendered harmless. An illness? It is researched
               | until cured, regardless of the time, the cost, over
               | generations if need be. A car crash? They create their
               | separate system, slower, less efficient, costing hours,
               | but which has never cost a single life. Even for suicide
               | they track the cause, and so, patiently, blade by blade,
               | disarm Death. Death, of course, has many weapons, and, if
               | they have deprived him of a hundred million, he still has
               | enough at hand to keep them mortal. For now._
        
               | paulryanrogers wrote:
               | So we should not even try to help the sick because
               | 'death' has too many other ways to kill them?
        
               | philipkglass wrote:
               | I mean the opposite. We should continue seeking cures to
               | every fatal condition, from the common to the rare.
        
               | paulryanrogers wrote:
               | Thanks for clarifying. Apparently returning to Reddit has
               | made me cynical.
        
               | os2warpman wrote:
               | >There's no evidence to support that gene therapy will
               | ever be inexpensive.
               | 
               | My prediction is based on the number of efforts, too
               | numerous to list here, being undertaken to develop lab
               | equipment to automate the extremely labor-intensive
               | workflow and the accumulation of vast libraries of
               | CRISPR-Cas9 screens and dependency maps, the creation of
               | which are also expensive and labor-intensive.
        
               | primax wrote:
               | > There's no evidence to support that gene therapy will
               | ever be inexpensive. We can merely say that the process
               | may become less shockingly expensive.
               | 
               | A similar thing has been said about so many cutting edge
               | therapies and technologies in the past that I think
               | you'll end up being quite surprised.
               | 
               | Eventually someone will invent a machine that spits these
               | therapies out like espresso machines.
        
           | SquirrelOnFire wrote:
           | 30 million people in the US are affected by "rare" genetic
           | conditions.
        
             | dekhn wrote:
             | Yes, but the cures here aren't general. They're highly
             | specific, and the rare conditions have a long tail- large
             | numbers of different conditions, each with a very small
             | population of affected individuals, and likely, the
             | treatments will be somewhat customized for each type of
             | disease.
        
               | pfisherman wrote:
               | See my comment above. Getting approval for rare diseases
               | and expanding the indication to the common form of the
               | disease is a well established strategy in pharma.
        
               | dekhn wrote:
               | yes, but that's totally different from coming up with a
               | generalized treatment for a wide range of "rare"
               | diseases.
        
             | pfisherman wrote:
             | Also rare genetic diseases give insight into the underlying
             | mechanisms and pathology of common sporadic diseases, which
             | can be leveraged to develop new and better therapies.
             | 
             | Getting a new drug or therapy approved for a rare form of a
             | disease and then expanding the indication to the common
             | disease patient population is a well established strategy.
        
           | delfinom wrote:
           | Because reducing obesity, smoking and drinking is not a money
           | problem in the slightest.
        
           | DoesntMatter22 wrote:
           | I completely disagree, the things you mentioned are all
           | things which a person has a level of control over.
           | 
           | This is something beyond that, and is very valuable as this
           | baby has no actual means of fighting this issue at all.
           | 
           | And who's to say this won't lead to fixing the other things
           | anyway.
           | 
           | Great use of dollars
        
           | xiphias2 wrote:
           | It's super effective funding.
           | 
           | There are known DNA changes that would probably help all
           | people with chronic diseases, but it's ethically more
           | accepted to go for the more fatal diseases and cleaner cases
           | first, like a rare mutation with a high fix rate.
        
           | psychoslave wrote:
           | That is not comparable at all. To save people from obesity,
           | smoking and drinking, you don't need more resources on
           | fundamental research. You need different education, and
           | socio-economical programs, possibly even less funds on the
           | overall: if no resources is spent anymore in promoting bad
           | habits, you end up with more financial resources and a
           | healthier population.
           | 
           | Instead if no resources is allocated on developing all the
           | technical requirements to do such a thing, humanity ends up
           | with less tools to heal itself, and that's it.
        
           | caycep wrote:
           | a) that statement above has nothing to do with RFK
           | 
           | b) the whole point of NIH and other government research funds
           | is to pay for this sort of "not clearly an effective use of
           | dollars" type of research that Pfizer et al won't touch. but
           | you can look at a ton of future applications from this -
           | lipid packaging, CRISPR methods, drug delivery, etc that had
           | to be devised, and could conceivably be commercially viable
           | if the methodology is perfected and the cost comes down.
        
         | dylan604 wrote:
         | The current administration doesn't care about kids. They only
         | want you to not terminate a new kid from being born. That they
         | care lots about. What happens after birth is not their concern.
         | Also, I think when they say they want more babies, they want a
         | specific subset of babies to increase.
        
           | philipallstar wrote:
           | > The current administration doesn't care about kids.
           | 
           | Of course they do. But untold amounts spent on very few kids
           | could be spent elsewhere on many more. Federal budgets are a
           | zero-sum game.
           | 
           | > Also, I think when they say they want more babies, they
           | want a specific subset of babies to increase.
           | 
           | I've seen quite a few conservative commentators celebrate
           | that the massively disproportionate levels of African-
           | American abortion have been reduced, resulting in more
           | African-American people being born, and zero bemoaning it. So
           | maybe you're right.
        
       | colechristensen wrote:
       | >KJ has made medical history. The baby, now 9 1/2 months old,
       | became the first patient of any age to have a custom gene-editing
       | treatment, according to his doctors.
       | 
       | This is _not_ the first human to be treated with a treatment
       | under the wide umbrella of gene therapy based on their own edited
       | genes. There probably _is_ a more narrow first here but the
       | technical details get lost in journalism which is a shame.
        
         | jfarlow wrote:
         | "Custom" in that this therapy was designed AFTER a specific
         | patient showed a need, and then given to _that_ patient. In
         | most every other context a particular class of disease is
         | known, a drug designed, and then patients sought that have that
         | disease that matches the purpose of the drug.
         | 
         | What's intriguing is not the 'custom' part, but the speed part
         | (which permits it to be custom). Part of what makes CRISPR so
         | powerful is that it can easily be 'adjusted' to work on
         | different sequences based on a quick (DNA) string change - a
         | day or two. Prior custom protein engineering would take minimum
         | of months at full speed to 'adjust'.
         | 
         | That ease of manipulating DNA strings to enable rapid
         | turnaround is similar to the difference between old-school
         | protein based vaccines and the mRNA based vaccines. When you're
         | manipulating 'source code' nucleic acid sequences you can move
         | very quickly compared to manipulating the 'compiled' protein.
        
         | autoexec wrote:
         | Okay, I'll bite: Who then was the first patient of any age to
         | have a custom gene-editing treatment?
        
           | namuol wrote:
           | I know of at least one YouTuber who took a homemade treatment
           | that alerted his GI system DNA to produce lactase so he could
           | eat pizza again:
           | 
           | https://youtu.be/J3FcbFqSoQY
        
             | codeulike wrote:
             | That's not gene editing, but you could call it a gene
             | therapy - he's introducing new fragments of DNA/RNA into
             | his cells which then just float around and cause the right
             | enzyme get made. Sometimes called upregulation. This is
             | different to actually editing the existing DNA in the cell.
        
               | namuol wrote:
               | Good point - to be honest I didn't realize the difference
               | which is very significant from a treatment perspective.
        
           | agos wrote:
           | I remember six kids treated with a HIV retrovirus based
           | therapy in 2013 in Italy
        
         | caycep wrote:
         | I want to say, maybe it's better to say first human under
         | proper IRB/regulatory compliance. Some rogue academic in China
         | tried it a few years ago, if I recall, but with absolutely no
         | oversight and he was pilloried. Also I don't think there is
         | much details about what he actually did...
         | 
         | https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
        
           | dekhn wrote:
           | What the Chinese guy (He) did was completely different. He
           | permanently altered the germline in embryos, which means that
           | every cell in the resulting baby is transformed permanently
           | with the change he made. The work he did violated a wide
           | range of good practice (specifically, the change he made
           | didn't actually work for the goal he desired, and he also
           | ignored all the ethical advice around this experiment, and
           | avoided getting the necessary approvals).
           | 
           | This research is instead a therapy used to treat an already
           | born baby, and it doesn't modify all the cells in the body.
           | Many cells in the body that are transformed by this technique
           | will eventually die and be replaced by clones of stem cells
           | which weren't transformed. I haven't read in detail about
           | whether this therapy targets stem cells, and how long term
           | effective the treatment will be- hepatocytes (liver cells)
           | turn over constantly, so I would expect if the treatment did
           | not affect the hepatocyte stem cells, it would only last
           | ~months and the treatment would have to be repeated.
        
             | SubiculumCode wrote:
             | Do new liver cells always come from stem cells, not from
             | dividing liver cells? Are those heppatocyte stem cells
             | reside in the liver, or do they travel their via
             | migration,.or blood, etc?
             | 
             | A quick search suggests that liver regen involves dividing
             | mature liver cells to replace turnover. If so, I'd suspect
             | that they'd continue to carry the.crispr edit forward.
        
           | zardo wrote:
           | The major difference is that was a hereditary change. So
           | those changes could now diffuse throughout the species over
           | time. As I recall it was a change that reduces vulnerability
           | to HIV infection.
        
       | MrZander wrote:
       | > To accomplish that feat, the treatment is wrapped in fatty
       | lipid molecules to protect it from degradation in the blood on
       | its way to the liver, where the edit will be made. Inside the
       | lipids are instructions that command the cells to produce an
       | enzyme that edits the gene. They also carry a molecular GPS --
       | CRISPR -- which was altered to crawl along a person's DNA until
       | it finds the exact DNA letter that needs to be changed.
       | 
       | That is one of the most incredible things I have ever read.
        
         | poyu wrote:
         | Made it sound like it's a computer, is it Turing complete?
        
           | lordnacho wrote:
           | Wouldn't it be surprising if it weren't? There's a bunch of
           | things that are Turing complete, but they are not literally a
           | molecular tape with machinery to read and write it.
        
           | caycep wrote:
           | I think I recall reading at least some papers or at least
           | exercises trying to draw analogies between Turing machines
           | and ribosome/proteonsome and other type of cellular proteins,
           | but I can't remember back to that class some 20 years ago...
        
           | fwip wrote:
           | Not really. Delivering gene edits via CRISPR in this way is
           | more like editing a text file with a single application of a
           | regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
        
             | anthk wrote:
             | So, Perl or sed. If it's Perl, the guy from XKCD was right.
             | And, maybe, Larry Wall.
        
             | xarope wrote:
             | TIL my years of perl regex'ing was preparing me for a
             | future of DNA gene warfare
             | 
             | (core war, anybody?)
        
               | duskwuff wrote:
               | I don't know if it still is, but, for a while, Perl was
               | actually fairly popular in bioinformatics:
               | https://bioperl.org/
        
           | koeng wrote:
           | It's fundamentally different than a computer and arguably
           | more complete.
           | 
           | The talk of "crawling along the genome" is kinda
           | fundamentally wrong though and is a bit irking - CRISPR kinda
           | just bumps around until it hits a PAM site, in which case it
           | starts checking against sgRNA. Much more random than they
           | make it seem
        
             | anthk wrote:
             | This is crazier: https://www.sciencealert.com/are-we-all-
             | quantum-computers-wi...
             | 
             | About CRISP, it's like the ultimate Perl+Regex for the
             | body.
        
               | dagurp wrote:
               | sounds more like sed
        
               | anthk wrote:
               | Perl and awk can do everything sed(1) does, but it an
               | easier way.
        
             | drjasonharrison wrote:
             | "Bumps around until it hits" sounds like a set of magnets
             | arranged to only mate up in a specific direction. Except we
             | have four nucleotides rather than only two magnetic poles.
        
           | Robotbeat wrote:
           | Yeah, in some ways, the genetic code and molecular biology
           | around transcription, etc, more closely resembles the
           | abstract Turing Machine than an actual computer does.
           | Absolutely fascinating that the messy world of biology ends
           | up being pretty analogous to the clean world of binary logic.
           | Gene sizes are expressed in kilobases, where a base carries 2
           | bits of information.
        
           | davedx wrote:
           | Sounds kind of like the infinite tape machine....
        
             | mr_toad wrote:
             | About 6 billion letters in human DNA.
        
           | buzzy_hacker wrote:
           | Made me think of                   It was only in college,
           | when I read Douglas Hofstadter's Godel, Escher, Bach, that I
           | came to understand cells as recursively self-modifying
           | programs. The language alone was evocative. It suggested that
           | the embryo--DNA making RNA, RNA making protein, protein
           | regulating the transcription of DNA into RNA--was like a
           | small Lisp program, with macros begetting macros begetting
           | macros, the source code containing within it all of the
           | instructions required for life on Earth. Could anything more
           | interesting be imagined?              Someone should have
           | said this to me:              > Imagine a flashy spaceship
           | lands in your backyard. The door opens and you are invited to
           | investigate everything to see what you can learn. The
           | technology is clearly millions of years beyond what we can
           | make.         >         > This is biology.
           | -Bert Hubert, "Our Amazing Immune System"
           | 
           | from https://jsomers.net/i-should-have-loved-biology/
        
             | duskwuff wrote:
             | >> Imagine a flashy spaceship
             | 
             | I misread this as "fleshy" for a moment, and the quote
             | almost works better that way.
        
               | floam wrote:
               | Me too. It did. Huh.
        
           | dekhn wrote:
           | This system isn't really turing complete, but existing
           | biology provides everything required to make a computer which
           | is Turing complete (assuming non-infinite tape size).
           | 
           | True programmatic biology is still very underdeveloped. I
           | have seen logic gates, memory, and state machines all
           | implemented, but I don't think anybody has built somethign
           | with a straightforward instruction set, program counter,
           | addressable RAM, and registers that was useful enough to
           | justify advanced research.
        
           | joshmarlow wrote:
           | If this thread interests you, you should check out "Blood
           | Music" by Greg Bear. It's pretty old but the premise is that
           | a researcher 'closes the loop' in a bunch of cells by making
           | them able to edit their own DNA - thus making them Turing
           | Complete.
           | 
           | Hilarity subsequently ensues.
        
             | dekhn wrote:
             | Cells are already able to edit their own DNA. Examples
             | include the yeast mating switch, in which the "active" gene
             | is replaced by one of two templates, determining the role
             | the yeast plays in mating (https://en.wikipedia.org/wiki/Ma
             | ting_of_yeast#Mechanics_of_t...)
             | 
             | Further, your immune system does some clever combinatorial
             | swapping to achieve diversity
             | (https://en.wikipedia.org/wiki/V(D)J_recombination). The
             | generated diversity is then screened by the immune system
             | to find highly effective antibodies that bind to specific
             | foreign invaders.
             | 
             | Doing something actually interesting from an engineering
             | perspective makes for fun science fiction, but as always,
             | the specific details in that story would be a very unlikely
             | outcome.
        
             | xarope wrote:
             | As I get older, I'd be happy with some minor incremental
             | progress on addressing myopia and hyperopia.
        
         | Balgair wrote:
         | One other fun part of gene editing _in vivo_ is that we don 't
         | actually use GACU (T in DNA). It turns out that if you use
         | Pseudouridine (Ps) instead of uridine (U) then the body's
         | immune system doesn't nearly alarm as much, as it doesn't
         | really see that mRNA as quite so dangerous. _But_ , the RNA ->
         | Protein equipment will just make protiens it without any
         | problems.
         | 
         | Which, yeah, that's a _miraculous_ discovery. And it was well
         | worth the 2023 Nobel in Medicine.
         | 
         | Like, the whole system for gene editing _in vivo_ that we 've
         | developed is just crazy little discovery after crazy little
         | discovery. It's all sooooo freakin' cool.
         | 
         | https://en.wikipedia.org/wiki/Pseudouridine
        
           | Teever wrote:
           | I suppose a downside (depending on your perspective) of this
           | is that it will make people who are genetically modified in
           | this fashion trivial to detect.
           | 
           | That's good if your goals are to detect genetic modification
           | which may be considered cheating in competitive sports.
           | 
           | That's bad if your goals are to detect genetically modified
           | people and discriminate against them.
           | 
           | I see a near future where the kind of people who loathe
           | things like vaccines and genuinely believe that vaccines can
           | spread illness to the non-vaccinated feel the same way about
           | other things like genetic modification and use legal
           | mechanisms to discriminate and persecute people who are
           | genetically modified.
        
             | ale42 wrote:
             | > it will make people who are genetically modified in this
             | fashion trivial to detect.
             | 
             | I'm not totally sure. If I understand it correctly, the
             | mRNA contains pseudouridine, and it makes the protein that
             | will edit the DNA. The edited DNA should look like a normal
             | one.
        
               | Teever wrote:
               | Ah. That makes sense. My mistake.
        
             | LawrenceKerr wrote:
             | If you're going to make the comparison with vaccines, and
             | if history is any indication, the more realistic worry
             | would be the other way around (since that's where the money
             | is): that genetic modifications will be mandated, and that
             | those who object will be discriminated against.
             | 
             | [And no, I am not anti-vax, nor anti-gene-editing.]
        
               | khazhoux wrote:
               | "What do you mean you haven't modified your chromosome 7
               | CFTR gene? _And you're planning to have children???_ "
        
               | kulahan wrote:
               | It wouldn't be crazy if I teleported 50 years in the
               | future and heard someone tell me that not doing this is
               | akin to child abuse. Obviously all suffering is relative,
               | etc. etc., but it's just interesting to imagine a world
               | where the societal pressure to make a perfect child is
               | high.
        
               | _whiteCaps_ wrote:
               | I don't know anything about gene editing, but my
               | grandmother was a carrier of the BRCA mutation. It would
               | have saved a lot of heartbreak in my family if that could
               | have been detected and repaired. My aunt, mom, and
               | brother (age 4) all died of cancer. I'm just glad that my
               | mom didn't know she had the mutation and passed it on to
               | her child.
        
             | sfink wrote:
             | Careful with qualifiers there. I genuinely believe that
             | vaccines can spread illness to the non-vaccinated, since it
             | has happened many times and is well-documented. For
             | example, it's why only the inactivated (aka "dead" virus)
             | polio vaccine has been used in the US since 2000.
             | 
             | I'm not arguing about whether the risks of the attenuated
             | virus outweigh the benefits. I think the data are very
             | clear there. (Heh -- and I'm sure the vast majority of
             | people will agree with that statement, even if they
             | disagree on what the clear answer is....)
             | 
             | It's just that one shouldn't mock a belief without
             | including the necessary qualifiers, as otherwise you're
             | setting up an argument that can be invalidated by being
             | shown to be factually incorrect.
             | 
             | As for genetic modification of humans, IMO there are a lot
             | of very good reasons to be wary, most of them social. Fatal
             | hereditary conditions are obviously an easy call. What
             | about autism (not saying there's a genetic link there to
             | use, just a what if)? Or other neurodivergence? Like being
             | a troublemaker in class? Or voting for the party that
             | doesn't control the medical incentive structure? Heck,
             | let's stick with the fatal hereditary conditions, and say
             | the editing does not affect germ cells. Is it ok if the
             | human race gradually becomes dependent on gene editing to
             | produce viable offspring? Or let's say it does extend to
             | germ cells. The population with resources becomes
             | genetically superior (eg in the sense of natural lifespan
             | and lower medical costs) to those without, creating a solid
             | scientific rationale for eugenics. Think of it as redlining
             | carved into our blood.
             | 
             | I don't think discrimination against the genetically
             | modified is the only potential problem here.
             | 
             | As humans, we'll deal with these problems the way we've
             | dealt with everything else transformational. Namely: very,
             | very badly.
        
               | catigula wrote:
               | I mean, I feel like autism is a terrible example here,
               | it's not just some quirky personality trait, it's a
               | reality people live with that runs the gamut from
               | difficult to completely debilitating. Even the more mild
               | forms of autism cause extreme difficulty in many aspects
               | of life. If that was curable or preventable, that'd be
               | great.
               | 
               | If it turns out some pathogen or chemical made me
               | autistic, regardless of whether or not I could be cured
               | as an adult, I'd have certainly preferred to live the
               | reality where I had been as a child.
        
               | sfink wrote:
               | Sure, the purpose was to illustrate a slippery slope, and
               | curing autism is meant to be more obviously good than
               | abolishing all forms of neurodivergence but less
               | obviously good than fixing fatal hereditary diseases.
               | 
               | I'm not going to claim that I know the perfect place to
               | draw the line.
        
               | zmmmmm wrote:
               | I think a better reason autism is a bad example is that
               | part of its definition is that it is a consequence of
               | fundamental brain structure and development
               | (differentiating it from other psychological disorders
               | which are acquired and more malleable). These aren't
               | things you will "undo" with some gene edits. The whole
               | brain has developed in a different way. Short of re-
               | growing them a new brain you aren't going to change that
               | (assuming you wanted to).
        
               | kulahan wrote:
               | I think scientists have believed for a while that any
               | type of "autism cure" would need to be extremely early
               | intervention for maximum effectiveness for exactly this
               | reason. I remember speaking with a team that was studying
               | detection of autism in the womb for this exact reason.
        
               | jcims wrote:
               | >...and say the editing does not affect germ cells.
               | 
               | To me the wildest scenarios take this off the table.
        
               | mr_toad wrote:
               | > vaccines can spread illness to the non-vaccinated,
               | since it has happened many times and is well-documented
               | 
               | Nothing in medicine is certain. Nearly any medical
               | treatment has a small chance it could kill you. There's a
               | small, but non-zero chance of a lethal infection even if
               | they injected you with saline, odds that rise
               | dramatically in less than sanitary conditions.
               | 
               | Ironically the use of the attenuated oral vaccine for
               | polio was because of the risk of infection in places
               | where the availability of sterile syringes was hard to
               | guarantee. It's all about the relative odds.
        
               | nuc1e0n wrote:
               | At one time organ transplants were considered an ethical
               | grey area (perhaps they still are by some), but I think
               | most people now would consider it better to save lives in
               | such a manner when it only brings help to those who need
               | it and it's possible to, compared to the alternative.
               | Having the capability may mean that things like organ
               | theft now exist, but the benefits around the world
               | outweigh the nastiness that has always come as part of
               | human nature.
        
               | sfink wrote:
               | I agree that organ transplants are a net positive, and in
               | fact are far less susceptible to unintended consequences
               | (there's a pretty low limit to the number of organs and
               | operations involved, for one.)
               | 
               | I also think that gene repair is a net positive. I would
               | just like us to, for once, look ahead and foresee some of
               | the foreseeable consequences and act to mitigate them
               | _before_ the bulk of the damage is done.
               | 
               | I don't think it's necessary to slow the development;
               | gene therapy is too desperately needed, and slowing it
               | down so that we can prepare is not going to cause us to
               | prepare.
        
             | prisenco wrote:
             | I'm less interested in detecting genetic modification for
             | the purposes of discrimination than making sure it's
             | available to everyone.
             | 
             | Assuming requisite safety of course.
        
               | ddq wrote:
               | I'm more concerned about the possible negative unintended
               | consequences of making it available to everyone first.
               | Genetic modification is well-explored Pandora's Box in
               | science fiction and present humanity seems so ill-
               | equipped in collective philosophy and reason to handle a
               | paradigm shift of that magnitude.
        
             | jillyboel wrote:
             | Don't be silly, the rich will want their babies to be
             | perfect so gene editing will be legal and considered OK.
        
               | _bin_ wrote:
               | Can you explain why this is a bad thing, or is it just
               | ""the rich" bad"?
        
               | jhickok wrote:
               | Not OP, but presumably it's because it could cement a
               | permanent divide between classes. We still have quite a
               | bit of upward mobility in the US, but health is a
               | tremendous predictor of future outcomes, so gating that
               | to the rich is dangerous to the stability of society in
               | that way.
        
               | _bin_ wrote:
               | This seems like more of an issue with accessibility of
               | the treatment than the treatment itself
               | 
               | If we could make most children smart, productive,
               | ambitious, courteous, civil, conscientious, honorable,
               | strong... the value to society is probably high enough to
               | justify covering it for almost anyone.
        
               | boroboro4 wrote:
               | The society already can invest a lot (through public
               | education) to "make most children smart, productive,
               | ambitious ...".
               | 
               | Somehow society (or indeed parts of it) decided to use it
               | as a tool of further segregation rather than overall
               | prosperity. I'm afraid same might apply to this.
        
               | _bin_ wrote:
               | We "invest" more than almost anyone. 38% higher than the
               | OECD average. I don't find discussions about throwing
               | more money at the problem to be constructive so much as a
               | way to ignore other issues at play.
               | 
               | I don't really see how this affects e.g. what I do for my
               | children. I will absolutely be turning them into the
               | closest to superhuman the current state of treatments
               | lets me, traveling internationally if I need to. If
               | someone else decides to segregate access to treatment,
               | that is a separate, wrong act that will not hold me back
               | from giving my children every advantage possible.
               | 
               | (Yes, I understand this is a positional arms race, but 1.
               | that doesn't change the individually-optimal outcome, and
               | 2. that doesn't change that society net benefits from
               | it.)
        
               | boroboro4 wrote:
               | I don't mean to invest as to spend more money, rather to
               | spend money better and in a more equal way. While USA
               | spends a lot of money on education I don't think it
               | translates in better education on average. Even if this
               | was beneficial for the society in general.
               | 
               | I am, afraid, that this kind of genome modification will
               | further increase divide in a society and turn social
               | lifts off even more. I.e. it's not gonna be your kid to
               | get "improve" brain genes first, and later your kid
               | wouldn't get a chance to get it ever again for their
               | children.
               | 
               | Just to be clear I'm not against of the progress, this
               | thing is fascinating and really shows how awesome humans
               | are. And I get why you'll get it if possible for your
               | kid. I'm just not sure its benefits for the society mean
               | it's gonna be anyhow affordable for regular people.
        
               | _bin_ wrote:
               | You will have a really hard time convincing Americans to
               | keep paying high taxes while funding is pulled from their
               | children's schools and redistributed to inner cities and
               | ruralia. My observations suggest the problem for the
               | latter isn't financial.
        
               | concordDance wrote:
               | This is already true to a great extent. A family with
               | lots of genetic health conditions are probably going to
               | remain poor.
        
               | jillyboel wrote:
               | I'm explaining that gene modification will not be
               | considered illegal or bad because the rich will have a
               | vested interest in it being legal. This is a reply to GP
               | saying:
               | 
               | > use legal mechanisms to discriminate and persecute
               | people who are genetically modified
               | 
               | I believe there is no way this will happen, because legal
               | mechanisms are driven by the whims of the rich, and they
               | will want gene editing to be legal. So there will beno
               | legal mechanisms to discriminate against those who have
               | been edited.
        
             | junon wrote:
             | RNA is a byproduct, not a "source of truth" in technical
             | terms. The DNA is. DNA is converted to RNA and then
             | executed and then discarded, per my understanding. The DNA
             | is still AGCT.
        
           | alecco wrote:
           | > [...] then the body's immune system doesn't nearly alarm as
           | much, as it doesn't really see that mRNA as quite so
           | dangerous
           | 
           | Please tell me there are measures to prevent this going into
           | the wild. Please tell me this won't be used in large-scale
           | industrial farming.
        
             | imcritic wrote:
             | Farming? This will be used in warfare.
        
               | Balgair wrote:
               | Not under the current way we do things, I don't imagine.
               | 
               | So the real trick here isn't the mRNA, it's the
               | nanobubbles. Basically, you're putting these bits of mRNA
               | into these little fat bubbles and then injecting those
               | into the blood. Making those bubble shelf stable is
               | _really hard_ , hence the issues with temperature and the
               | covid vaccine. To then make those little fat bubbles
               | stable-ish in the blood is also a really hard thing to
               | do. They have to get to the right places (in this baby's
               | case, the liver) and then degrade there, drop off the
               | mRNA, and not mess up other tissues all that much. Like,
               | it's not terrible to make these micelles degrade _in
               | vivo_ , but to have them do that _and_ not degrade in the
               | tubes, ... wow... that is _really_ difficult. There 's a
               | reason that Moderna is so highly valued, and it's these
               | bubbles.
               | 
               | To try to then put these in a weapon that could do this
               | though the airways would be, like, nearly impossible.
               | Like, as in I think the second law of thermodynamics, let
               | alone biology, and then simple industrial countermeasure
               | like a N95 respirator, yeah, I think all of that makes it
               | pretty much impossible to weaponize.
               | 
               | (Hedging my bets here: I don't know if they had to do all
               | that with this baby, as you can kinda go from lab to baby
               | really fast, since it's such a special case. But for mRNA
               | based vaccines and cancer treatments, you have to deal
               | with the shelf stable issue)
               | 
               | (Also, other bio people, yes, I am trying to explain to
               | laymen here. Please chime in and tell me how I'm wrong
               | here)
        
               | okayishdefaults wrote:
               | I think it doesn't need to be a direct weapon to be used
               | in warfare. You can genetically modify your own military.
        
               | Balgair wrote:
               | Yeah good point!
               | 
               | Something that a lot of people are unaware of is that US
               | Military is allowed to do this. I forget the exact EO,
               | but it was signed by Clinton and is in the 12333 chain of
               | EOs. Mostly, this is used for the Anthrax vaccine. But,
               | it does give clearance to do other forms of medical
               | experimentation on warfighters.
               | 
               | No, really, I am serious here. This is true. I may have
               | the details a bit off, so sorry there, but they can and
               | do preform medical experiments on people without their
               | consent. Now, to be fair, France does this too. They do
               | sham surgeries over there. Non-consenting human medical
               | experimentation is quite the rabbit-hole.
               | 
               | So, I can kinda see in the next 10 years, certainly the
               | next 50, a routine shot given to warfighters to help them
               | with things like blood loss, or vitamin C production, or
               | fast twitch muscles, or whatever. The legal framework is
               | already there and has been for a while, it's just an
               | efficacy issue, honestly.
        
               | Muromec wrote:
               | That would be less effective than bio and chemical
               | weapons are. Which are not used because they just suck
        
               | kulahan wrote:
               | I'm not sure of by "they just suck" you meant to imply
               | that they're ineffective. If that's the case, I strongly
               | disagree. They are not used because somehow all countries
               | pretty much agreed they're way TOO effective and
               | horrific. Nobody wants it used on them, so nobody uses it
               | on anyone else.
               | 
               | I cannot imagine a more effective weapon than an
               | invisible gas that melts you alive, and there are MANY
               | chemical and bio examples of these types of weapons.
        
               | beeflet wrote:
               | The ceiling for the destruction caused by biological
               | weapons is far greater than chemical weapons. There is no
               | chemical weapon that can hijack the victim to make more
               | of it.
        
               | wffurr wrote:
               | >> They are not used because somehow all countries pretty
               | much agreed they're way TOO effective and horrific
               | 
               | That's the story but it doesn't hold up. Chemical weapons
               | were used as recently as the Syrian civil war. I also
               | think if they were really effective in modern warfare,
               | Russia would have long ago deployed them in Ukraine.
               | 
               | More here: https://acoup.blog/2020/03/20/collections-why-
               | dont-we-use-ch...
        
               | kulahan wrote:
               | What do you mean "if they were really effective"? We
               | still hand out CBRN gear and train in how to put
               | necessary parts on in seconds, because that's often how
               | little time you get before you're permanently
               | incapacitated. Mustard gas alone should prove this, and
               | that's an OLD chemical weapon.
               | 
               | Nowadays we have riot control agents that can be tailored
               | to demographics, react more violently in the presence of
               | sweat, or contain psychoactive ingredients. Nanoparticle
               | dispersion bypasses common gas masks and clothing
               | protection. Even if you're completely geared up, they can
               | be engineered to last on surfaces for a long time, or
               | react only in the presence of certain triggers. Imagine
               | thinking you're safe until someone turns on a certain
               | light bulb and you cook inside your protective gear
               | because you were actually exposed 12 hours earlier in an
               | undetectable manner.
        
               | wffurr wrote:
               | I'd encourage you to read the article. Chemical weapons
               | are effectively useless against a well-trained "modern
               | system" army. Part of that is the chemical warfare
               | equipment and vehicles, but mostly it's cover-and-
               | concealment. If you can actually find the enemy, it's
               | much faster and simpler to use the other vastly
               | destructive munitions that modern militaries have.
        
               | kulahan wrote:
               | I did, and it's really not very convincing at all. It
               | uses an example where a terror group in Japan was able to
               | injure thousands of people with a chemical attack, and
               | act as if this is... not a particularly effective
               | outcome?
               | 
               | Additionally, that "if you can find them" is doing some
               | pretty heavy lifting. The range of explosives and
               | kinetics is hilariously low, and the actual percentage of
               | your military with the level of mobility he seems to be
               | referring to is infinitesimal.
               | 
               | This argument more correctly explains why chemical
               | weapons aren't a great defense against precision strike
               | groups. It also doesn't get into detail with concepts
               | like dropping a bomb right in the middle of a firefight
               | knowing it literally cannot harm your own troops, short
               | of the physical metal accidentally falling on one of your
               | own troops.
        
               | wffurr wrote:
               | >> a terror group in Japan was able to injure thousands
               | of people with a chemical attack
               | 
               | A terror attack on civilians is a lot different than
               | modern militaries using them on each other.
        
             | Balgair wrote:
             | Yeah, it's not a drama.
             | 
             | The reason that the body doesn't alarm as much to
             | Pseudouridine, is that it's not a 'natural' RNA base.
             | Meaning that, for the most part, nature really never uses
             | it and so we haven't evolved to look out for it. Nature
             | uses Uridine and so immune systems have evolved to look out
             | for random bits of RNA in the body that use it and then
             | clean that all up.
             | 
             | It's like if you're looking to clean up legos in you house
             | with a romba that only cleans up legos. And all of a sudden
             | it finds a duplo. It's going to take a hot second to figure
             | out what to do with the duplo. And in that time, you can
             | sneak by and build a duplo fort. (Look, I know this analogy
             | is bad, but it's the best I can come up with on the fly,
             | sorry. If anyone else wnats to come up with a better one,
             | please do!).
             | 
             | The Pseudouridine is used up and degraded very quickly
             | inside the cell, minutes at the very very longest, more
             | like microseconds. It's just part of a messenger (the 'm'
             | in 'mRNA') to tell the cell to do things.
             | 
             | You might see mRNA gene editing in factory farms, but it
             | would just be easier to do germline editing instead and
             | skip spraying animals, plants, and fungi. Why waste the
             | equipment, right?
        
               | kulahan wrote:
               | I thought the analogy was good. They're meant to be
               | simple and easy to understand, not perfect
               | representations.
        
             | abracadaniel wrote:
             | As I understand it, there is nothing in nature that can
             | create it, so the mRNA can never be accidentally
             | replicated. It's a safety mechanism that prevents escape.
        
             | treyd wrote:
             | Industrial farming of what?
        
             | slashdev wrote:
             | Why would it be used in farming, you can edit the DNA
             | before fertilization in farming, no need to do anything in
             | vivo.
        
           | monkeycantype wrote:
           | I remember from a few few years back that the lipid coating
           | may have caused problems for the liver, when treating people
           | for diseases that needed to target a lot of tissue, such as
           | muscle disorders. Is that still the case?
        
             | Balgair wrote:
             | Unfortunately, I do not know. Sorry here.
             | 
             | If anyone else does know, please chime in!
        
             | mike_hearn wrote:
             | You remember correctly. Moderna had a lot of problems with
             | their drug trials due to the lipid nanoparticles they were
             | using to transport mRNA. They were toxic to the liver upon
             | repeat dosings. Unfortunately, it appears they never found
             | a fix for the problem. Instead they gave up and found a
             | "business solution" by pivoting from drugs to the (at the
             | time) less profitable vaccines, on the grounds that
             | vaccines are something you only need to take once so the
             | toxicity issue could be dodged. Doh. That was in 2017.
             | 
             | https://www.statnews.com/2017/01/10/moderna-trouble-mrna/
             | 
             | By the time COVID vaccines came around a few years later
             | there was no evidence they had fixed the problems with
             | lipid nanoparticle delivery. I looked for such evidence
             | extensively at the time, for example, announcements by
             | Moderna of breakthroughs or trials of new drugs. Today the
             | situation seems not much different. Note that Moderna's
             | wikipedia article has a section on "rare disease
             | therapeutics" but it's literally empty:
             | 
             | https://en.wikipedia.org/wiki/Moderna#Rare_disease_therapeu
             | t...
             | 
             | Because of their failure to progress beyond COVID vaccines
             | Moderna's share price got slaughtered, falling from a peak
             | of ~$450 to ~$25 today.
             | 
             | I don't know if other companies were able to find
             | breakthroughs here, after COVID I stopped following the
             | topic. Unfortunately, although mRNA tech has great
             | potential, when normal safety standards were reimposed it
             | appears that Moderna went back to being unable to make
             | anything safe enough to launch.
        
               | Jugurtha wrote:
               | What was the success of other means, such as sugars and
               | proteins? Something like glycocalyx or polysaccharide
               | capsules? Or HIV like deployment gp41/gp120?
        
               | Gareth321 wrote:
               | > on the grounds that vaccines are something you only
               | need to take once so the toxicity issue could be dodged
               | 
               | But we didn't take these vaccines once. We took many of
               | them. Am I to understand a known side effect is liver
               | toxicity for multiple doses?
        
               | mike_hearn wrote:
               | You have successfully read between the lines, yes.
        
               | Avamander wrote:
               | They have not.
        
               | popol12 wrote:
               | I guess the issue is not about taking the medicine once
               | vs twice, but rather << a few times >> vs << daily >>
        
               | heavyset_go wrote:
               | Toxicity depends on dose. COVID vaccines just need
               | micrograms of material to induce an immune response, I
               | imagine it takes more than that to edit the genes of a
               | large organ.
        
               | mike_hearn wrote:
               | There have sadly been cases where the vaccines did
               | perform unintended gene editing. It shows up as people
               | whose bodies are still producing spike protein months or
               | years after vaccination.
        
               | floam wrote:
               | Are you saying that there are cases of longer than
               | expected spike protein presence where these cases are
               | actually because gene editing took place?
        
           | maxerickson wrote:
           | Is this a troll? Pseudouridine mRNA isn't gene editing.
        
             | VierScar wrote:
             | What do you mean? Is mRNA not used to produce the enzyme
             | that these comments mentioned? I don't think they were
             | saying mRNA is gene editing itself. Just commenting on a
             | modified mRNA helping the process compared to normal mRNA.
             | Might be misunderstanding though so correct me if I am
        
               | maxerickson wrote:
               | I dunno, I think they are being sloppy and conflating
               | things. We can induce manufacture of proteins and can
               | design proteins that carry out gene editing, so we can
               | stack that knowledge together to induce cells to
               | manufacture proteins that carry out gene edits, but it's
               | the payload that is the gene editing, not the instruction
               | to make the protein.
               | 
               | Given the merry movement to call the COVID vaccines gene
               | editing, it rankles.
        
               | Balgair wrote:
               | Hey, yeah, I'm not the most up to date on the current
               | methods. Most of my knowhow is a bit out of date here. So
               | thanks for piping up to correct things.
               | 
               | Do you know of any good resources that I can use to get
               | up to speed on the exact methods they used for the baby?
               | 
               | My understanding, outdated as it is, is that we're using
               | the mRNA to go in and create CRISPR-CAS9 slicers/dicers
               | and additionally to that, the correct genes (not mRNA) to
               | get stitched in. I would love to know more about how I am
               | wrong here, as I am sure I'm not even close to really
               | understanding it.
               | 
               | Thanks!
        
               | ionwake wrote:
               | I think you're replying to someone edgelord about covid
               | who got confused about some mrna statement and then back
               | pedalled re-affirming what the article was about.
        
           | cm2187 wrote:
           | That also sounds like a recipe for a terrifying virus
        
             | dtpro20 wrote:
             | It's almost exactly the premise of the movie "I am Legend,"
             | But it uses CRISPR instead of a Virus as the delivery
             | mechanism.
        
             | vanderZwan wrote:
             | I would be surprised if viruses using U instead of T didn't
             | already exist. After all, don't _all_ viruses work by doing
             | gene editing in vivo, except just localized to one cell?
             | 
             | EDIT: well, I suppose the question is whether cells of
             | living beings could produce the U required for the viruses.
             | But if not, then a wild virus using U instead of T to
             | bypass our immunity also would not be a threat for that
             | very reason.
        
               | snalty wrote:
               | It's not the use of Uracil/Urimidine that bypasses the
               | immune system. RNA uses Uracil instead of thymine in all
               | organisms afaik, and RNA viruses certainly exist. It's
               | pseudouridine that's the magic stuff.
        
             | dapf wrote:
             | It sounds like Spiderman tech.
        
             | teekert wrote:
             | I feel a bit proud that humanity healed a baby with this
             | tech before any viruses were constructed/released.
        
             | Symmetry wrote:
             | It would allow a synthetic virus to get a foothold in your
             | cells more easily, but our cells don't make Pseudouridine
             | naturally which throws a big wrench in the ability of a
             | virus to copy itself. And without replication you don't
             | have a serious infection.
        
             | shiandow wrote:
             | I don't thnk the body has a way of making mRNA with
             | pseudouridine.
        
           | xkcd1963 wrote:
           | Wow that could be also abused by some future covid-lab to
           | bypass immunesystem and modify the DNA so the body
           | disfunctions
        
             | Balgair wrote:
             | Yeah, I mention this in some other comments that got greyed
             | out.
             | 
             | Basically, the real deal technology here is the lipid
             | bubbles that deliver the payloads to the right cells, not
             | the base modification. You can go look at them, and a lot
             | of other comments in this thread for more info on that
             | tech.
             | 
             | TLDR: No way that anyone can bypass anything. These lipid
             | bubbles are a miracle that they work at all; they're so
             | unstable, it boggles the mind we can even use them to begin
             | with. Doing any large scale DNA editing on an unsuspecting
             | population would be so insanely expensive and difficult, I
             | certain moving to the Moon would be cheaper.
        
         | shadowgovt wrote:
         | Gene therapies are pretty incredible. Some of them are still
         | making a button-hole with a machete, but that's relative to the
         | previous medical intervention of a button-hole with a tank's
         | main gun.
         | 
         | One of the treatments for sickle-cell involves switching off
         | the gene that makes the malfunctioning red blood cells, but of
         | course that's not sufficient; you'd stop making red blood cells
         | completely and you'd die. So it's combined with a modification
         | that switches _on_ a gene that all humans express pre-birth
         | that causes your body to make  "super-blood": red blood cells
         | with significantly more binding points for oxygen. This is
         | necessary because a fetus gets oxygen from its mother's blood,
         | so the increased binding affinity is useful for pulling the
         | oxygen towards the fetus at the placental interface. After
         | birth, expression of that gene is disabled and regular RBC
         | genes switch on.
         | 
         | So the therapy doesn't "fix" sickle RBCs; it disables the
         | body's ability to make them and re-enables fetal RBCs! I have
         | seen no literature on whether having fetal RBCs in adulthood
         | has any benefits or drawbacks (besides changing the affinity
         | ratio for their fetus if the patient gets pregnant, I imagine
         | increased-affinity RBC could help for athletics... But I also
         | imagine it requires more iron to generate them so has dietary
         | impact).
        
           | nomadpenguin wrote:
           | High affinity RBCs would actually be a disadvantage for
           | athletics. You actually don't need very high affinity to pick
           | up oxygen from the lungs -- your lungs are comparatively
           | extremely high in oxygen. What matters more is being able to
           | drop the oxygen off in peripheral tissues. Higher affinity
           | means that it's harder to actually deliver the oxygen, which
           | is why we evolutionarily developed the switch away from fetal
           | hemoglobin.
        
             | philsnow wrote:
             | I thought the evolutionary impetus for fetal hemoglobin was
             | because it greatly increases the efficiency of fetal oxygen
             | uptake across the placental interface?
             | 
             | From shadowgovt:
             | 
             | > I have seen no literature on whether having fetal RBCs in
             | adulthood has any benefits or drawbacks (besides changing
             | the affinity ratio for their fetus if the patient gets
             | pregnant
             | 
             | This was exactly the question that popped into my mind when
             | I read about switching from normal adult RBCs to fetal
             | RBCs: does this therapy reduce the likelihood of carrying a
             | baby to term?
        
               | nomadpenguin wrote:
               | Yes, that is true. I phrased that badly -- it's more that
               | we didn't take the evolutionary branch where we retain
               | the fetal hemoglobin because it is maladaptive in adults.
        
           | anon291 wrote:
           | I have natural persistence of fetal hemoglobin which
           | counteracts my inherited thalassemia trait.
           | 
           | No problems really..never knew I had it until I was told I
           | had thalassemia trait as part of genetic testing. My
           | hemoglobin panel shows fetal hemoglobin.
        
           | j45 wrote:
           | Appreciate the explanations and the analogies.
        
         | jjtheblunt wrote:
         | > That is one of the most incredible things I have ever read.
         | 
         | This is even more great reading behind the above:
         | 
         | https://en.wikipedia.org/wiki/Jennifer_Doudna
        
           | bengale wrote:
           | Walter Isaacson's book "The Code Breaker" is about this
           | subject. I couldn't put it down.
        
             | beoberha wrote:
             | All his books are like that. The Innovators is my personal
             | favorite.
        
           | ascorbic wrote:
           | A rare case where the list of awards she's received is so
           | long it needs a separate Wikipedia page https://en.wikipedia.
           | org/wiki/List_of_awards_and_honors_rece...
        
           | jcims wrote:
           | She's got a couple of great appearances on RadioLab.
        
           | jjtheblunt wrote:
           | Also
           | 
           | https://en.m.wikipedia.org/wiki/Emmanuelle_Charpentier
        
             | lysace wrote:
             | They shared the Nobel prize for CRISPR. Yet you chose to
             | lead with the American one. :/
        
               | jjtheblunt wrote:
               | That's because the link I shared immediately cites Doudna
               | and Charpentier as a team.
               | 
               | After edits were disabled, I thought perhaps there's a
               | page for Charpentier too, which there was, but later than
               | i could edit.
               | 
               | They're both amazing scientists.
        
           | amelius wrote:
           | A darker passage in the history of gene editing, but still an
           | interesting story and something not to forget:
           | 
           | https://www.sciencehistory.org/stories/magazine/the-death-
           | of...
        
         | fsndz wrote:
         | Never bet against science !
        
         | znpy wrote:
         | Yep, this is truly incredible!
        
         | ac29 wrote:
         | > To accomplish that feat, the treatment is wrapped in fatty
         | lipid molecules to protect it from degradation in the blood on
         | its way to the liver, where the edit will be made. Inside the
         | lipids are instructions that command the cells to produce an
         | enzyme that edits the gene.
         | 
         | This isnt entirely unlike the method mRNA vaccines use. Through
         | some clever biochemistry, mRNA vaccines get bits of code into
         | cells where the cell's built in code compilers manufacture
         | proteins that induce immunity.
         | 
         | We have developed software patches for our biology.
        
         | _heimdall wrote:
         | I know someone well who works in this space, personalized gene
         | therapy as cancer treatment.
         | 
         | > until it finds the exact DNA letter that needs to be changed.
         | 
         | This pine is disingenuous (at best). There is no way of
         | guaranteeing where the DNA is inserted. It is designed to only
         | slot into a very specific portion of the DNA but they don't
         | have a way to control that precisely, the accuracy is high but
         | "exact DNA letter" is skipping over a few pretty important
         | details.
         | 
         | To be clear I'm not saying it is ineffective or unsafe, only
         | that the claim made is marketing speak and not actually true.
        
           | Thebroser wrote:
           | The approach they used which is base editing doesn't actually
           | insert or remove DNA, it actually uses an enzyme to convert
           | one base to another, which is much safer as this doesn't
           | require a double strand break in DNA:
           | https://blog.addgene.org/single-base-editing-with-crispr
        
             | _heimdall wrote:
             | That is interesting, I didn't catch the difference my first
             | time through the article.
             | 
             | I do still question their claim of 100% precise results
             | though. At least based on that high level description I can
             | definitely see it being safer, but I question any
             | scientific claim that is an absolute.
             | 
             | Specific to the editing vs insertion mechanism, I question
             | how it doesn't run into similar constraints where the
             | mechanics of targeting exact portions of the DNA can
             | occasionally miss or impact the wrong segment of DNA
             | entirely.
             | 
             | I haven't dug as deeply down the base pair conversion
             | though, so I could absolutely be wrong!
        
         | yieldcrv wrote:
         | Running this article through GPT and asking it more questions
         | is one of the most incredible allocations of productivity I
         | have ever seen
        
         | dclowd9901 wrote:
         | I literally said the same thing out loud.
         | 
         | I had heard about CRISPR a while back but most reporting on it
         | kind of hand waved over the mechanisms of how it actually
         | accomplishes its work. What these researchers have figured out
         | to make this work absolutely blows my mind.
        
           | j16sdiz wrote:
           | AFAICT, CRISPR still make many bad edits. We relies on the
           | fact that most of those bad edit won't survive.
        
             | rubidium wrote:
             | It can make "bad edits" eg off target effects. But in this
             | case there were, as far as is known, none. It's aided that
             | this was a single nucleotide defect.
             | 
             | They specifically tested for off target edits in the mouse
             | study and found no harmful edits (and very rare off target
             | ones). That plus the specific targeting of the liver cells
             | (no germ line effect expected), makes this a low risk
             | approach and certainly better than doing nothing.
        
         | cryptoegorophy wrote:
         | How does it know how to gps around? From what I know everything
         | down there is a chemical reaction with some minimal physical
         | motion, but how do you program it to know where to change and
         | what and how.
        
           | TheJoeMan wrote:
           | It's more like a "ctrl+F" for DNA. Hopefully there's only 1
           | match (the target site).
        
             | 0x1ceb00da wrote:
             | So you create a molecule that binds to a certain location
             | in the dna, and then deploy a billion of them?
        
               | rubidium wrote:
               | More or less, yes.
               | 
               | An interesting part of the study was determining what a
               | clinical dose _should_ be. You need enough to edit enough
               | liver cells. But don't really want to completely overdo
               | it to limit potentially negative side effects. Seems like
               | they got it right enough here, with the first dose having
               | some effect and the subsequent dose having more.
        
               | Tuna-Fish wrote:
               | You need billions to cover multiple cells, you don't need
               | many for a cell.
               | 
               | The counterintuitive part is how fast thermal motion is
               | relative to the size of dna.
               | 
               | In body temperature water, the thermal velocity of water
               | molecules jostling around everything is ~600m/s. The
               | nucleus of a human cell is ~6um in diameter. That is,
               | your average water molecule bounces around at a speed
               | that makes it move from one end of the nucleus to another
               | roughly 100 million times per second.
               | 
               | Larger molecules move more slowly, but they still zip
               | around fast enough that nothing needs to "seek" to a
               | specific position in a cell to get there, everything will
               | touch everything just from thermal random walk in a very
               | short time. So how biology works is that inside the cell
               | there might be just one messenger, which will have to hit
               | a specific piece of dna just right in order to do
               | anything, but that's still nearly instantaneous from our
               | perspective.
        
             | dtpro20 wrote:
             | Well its more like search and replace, where you cross your
             | fingers that it only replaces the words you are trying
             | replace without impacting the rest of the text in the
             | document.
        
           | Thebroser wrote:
           | Add gene has a great guide as to what goes on at the
           | molecular level: https://www.addgene.org/guides/crispr/
           | 
           | Essentially you can design an rna molecular that contains a
           | 20 nucleotide long sequence that can target your region of
           | interest, with the caveat that there is a standard
           | recognition sequence proximal to your sequence of interest
           | (PAM sequence)
        
           | bglazer wrote:
           | It doesn't know anything about where it "needs" to go. One of
           | the weirder and more unintuitive things about molecular
           | biology is just how fast everything moves inside a cell. The
           | CRISPR molecule diffuses from one side of the nucleus to the
           | other in a couple seconds and probably bumps into the
           | entirety of the genome in a matter of minutes or hours. It's
           | very, very crowded inside cells, proteins and DNA and
           | metabolites are constantly bumping into each other and are
           | tumbling around at frankly incomprehensible rates. So,
           | nothing needs to "know" where it needs to go, it simply gets
           | pushed and jostled around until arrives there and then the
           | attraction between the CRISPR's RNA and the DNA takes over
        
             | drjasonharrison wrote:
             | This sounds so much like "simulated annealing" with
             | reactive components and almost no lack of energy in the
             | system. Various energies/reactions occur, which unlock or
             | lock out other possible reactions.
        
         | vmurthy wrote:
         | Cue the book "The Code Breaker" [0]. I read it a long time ago
         | and such an incredible book and journey by Jennifer Doudna and
         | Emmanuel Charpentier. Do check it out
         | 
         | https://en.wikipedia.org/wiki/The_Code_Breaker
        
         | ziofill wrote:
         | A chemist friend of mine did his thesis on lipid vesicles, and
         | I remember my mind being blown when he told me these are
         | modelled as a liquid on the 2D plane of the membrane, but as a
         | solid on the 1D orthogonal direction because the energy to swap
         | two lipid molecules side by side is incredibly low (because it
         | makes barely any difference), while the energy to swap them
         | orthogonally to the membrane is much larger (because they would
         | point in the wrong direction).
        
           | ajkjk wrote:
           | Oh that's neat
        
         | verisimi wrote:
         | Once the gene has been edited, things will work. But at some
         | point that cell will die. Why would the replacement cell also
         | have the edit? The DNA in the rest of the body's cells will
         | still not be correct.
        
           | riffraff wrote:
           | When cells duplicate they have the same (altered) DNA so the
           | mutated cells survive.
           | 
           | You'll end up with mosaicism (cells with different DNA) but
           | presumably you have enough of the new cells to fix the
           | problem the original ones had.
           | 
           | You don't need to fix all the body, you just need to fix some
           | of the, say, liver, and you're good.
        
         | esalman wrote:
         | Thanks to DOGE you might read less and less about this kind of
         | things.
        
           | shafyy wrote:
           | Unfortunately, this is true. From the article:
           | 
           | > _The implications of the treatment go far beyond treating
           | KJ, said Dr. Peter Marks, who was the Food and Drug
           | Administration official overseeing gene-therapy regulation
           | until he recently resigned over disagreements with Robert F.
           | Kennedy Jr., the secretary of health and human services._
        
         | pishpash wrote:
         | Also presents a terrifying prospect of malicious use.
        
         | DrScientist wrote:
         | Bear in mind that they intentionally choose something that was
         | soluble - ie the easiest thing possible. So it's doesn't mean
         | everything is now solvable.
         | 
         | For example it's no coincidence this is a liver disease as
         | basically almost everything you inject in the bloodstream ends
         | up concentrating in the liver by default - if you needed to
         | target another organ with your LNP it would be much harder.
         | Most of the time people are trying to stop stuff accumulating
         | in the liver!
         | 
         | The liver has other special properties that are helpful as
         | well.
         | 
         | Having said all that - it is still a massive achievement.
         | 
         | > That is one of the most incredible things I have ever read.
         | 
         | Biology is incredible - and you can do incredible things if you
         | leverage it.
        
           | abcd_f wrote:
           | > that was soluble
           | 
           | solvable
        
             | DrScientist wrote:
             | soluble has two meanings.
             | 
             | - able to dissolve in solvent
             | 
             | - able to be solved.
        
               | jakeydus wrote:
               | Huh, TIL!
        
               | abcd_f wrote:
               | Is the second meaning archaic?
        
         | Den_VR wrote:
         | You should have seen the homebrew guy's talk on DIY CRISPR
         | where he injected himself on stage. And that was years ago.
         | Incredible times for incredible work.
        
         | harhargange wrote:
         | I work on lipids and i myself didn't know they could be so much
         | practically important.
        
       | forgotpwagain wrote:
       | Detailed New England Journal of Medicine article about this case:
       | https://www.nejm.org/doi/full/10.1056/NEJMoa2504747
       | 
       | And an Editorial piece (more technical than the NYT):
       | https://www.nejm.org/doi/full/10.1056/NEJMe2505721
        
         | caycep wrote:
         | thanks for this, I think all these lay articles on biomedical
         | news should definitely be accompanied by the paper
        
           | bookofjoe wrote:
           | I always try but way more often than not the paper is
           | paywalled.
        
         | n3uman wrote:
         | One of the authors: Julia L Hacker
        
       | vessenes wrote:
       | NYT isn't super specific here, but they made it sound like the
       | disease treated is liver related. My understanding is that the
       | liver is a good place to start with CRISPR-type gene treatments,
       | in that the liver normally deals with anomalous shit in your
       | bloodstream, say, like CRISPR type edits. So anywhere outside the
       | liver is going to be significantly harder to get really broad
       | uptake of gene edits.
       | 
       | It's crazy encouraging that this worked out for this kid, and I'm
       | somewhat shocked this treatment was approved in the US - I don't
       | think of us as very aggressive in areas like this. But to me,
       | really hopeful and interesting.
        
         | scotty79 wrote:
         | I don't think it's gonna be that hard. All cells that blood
         | reaches were happily taking mRNA vaccine.
        
           | derektank wrote:
           | I hate to break it to you, but it will be substantially more
           | difficult to target other organ systems. The liver is
           | uniquely easy to target with our current vectors.
           | 
           | Right off the bat, the liver receives roughly a quarter of
           | all cardiac output, either directly or second hand from the
           | digestive organs. Additionally, the liver has a fenestrated
           | endothelium which, while not completely unique in the body,
           | uniquely allows molecules like lipid nanoparticles (LNPs) to
           | access liver cells. Finally, the liver is the site of most
           | lipoprotein processing, and LNPs can be designed to take
           | advantage of the existing pathways to get the gene editing
           | mRNA into the hepatocytes. All this is to say that if you
           | have a genetic condition that primarily effects the liver,
           | there's a lot more hope for treatment in the near term than
           | for others.
           | 
           | Good lecture on the difficulties of finding appropriate
           | platforms for delivering gene therapies to cells for anyone
           | interested [1]
           | 
           | [1] https://youtu.be/6URTjoK58Yc
        
           | XorNot wrote:
           | No they were not. A vaccine triggers an immune response, not
           | a functional change.
           | 
           | mRNA vaccines are highly localized: you get a sore arm
           | because most of it only gets taken up by muscle cells around
           | the injection site, which spend some time producing the
           | antigen and triggering a primary immune response (the
           | inflammation aka the sore arm).
        
             | scotty79 wrote:
             | Still it needs to enter the cells all the same.
             | 
             | As for being localized it's true however after vaccine dose
             | S proteins have been detected also in remote locations in
             | the body because you can't make something 100% localized.
             | 
             | If you had an infusion that doesn't trigger immune system
             | you could just increase the dose significantly, put it in
             | the blood and most likely it would have reached all cells
             | that blood reaches.
        
               | im3w1l wrote:
               | Last I heard those gene editing things lead to so called
               | of-target edits, so they were basically corrupting random
               | dna. Now in this case the baby would have died without
               | this treatment so clearly benefits outweight the risks.
               | But even then they probably want to have the dose be as
               | low as possible.
               | 
               | But I'm speculating a bit here.
        
             | xrhobo wrote:
             | What I find interesting about the covid mRNA vaccine is I
             | remember being sick in March 2020 and I can't remember
             | being sick since.
             | 
             | I can remember getting a sniffle at night and waking up
             | fine the next morning a few times.
             | 
             | I think I had two doses of covid mRNA vaccine.
             | 
             | I have actually forgot what it is like to be sick. It
             | almost feels like the covid vaccine gave me some kind of
             | super immunity. I never get the flu shot either. I have not
             | had the flu in 5 years for sure.
        
               | BrawnyBadger53 wrote:
               | I think this is more likely a result of increased
               | standards of cleanliness that have remained
        
         | oceansky wrote:
         | It is caused by a missing enzyme in the liver, yes.
        
         | anarticle wrote:
         | Specifically it is this:
         | https://en.wikipedia.org/wiki/Carbamoyl_phosphate_synthetase...
         | 
         | People born with this lack the enzyme CPS1, which screws up the
         | urea cycle and causes a build up of ammonia. Ammonia build up
         | is bad for your nervous system.
        
         | cdcox wrote:
         | You are right, current CRISPR systems tends to accumulate in
         | the liver. Most CRISPR companies have shifted their focus to
         | the liver over time because it's easiest to deliver there. Most
         | viruses people use to target other organs are not large enough
         | to carry CRISPR and lipid nanoparticles with CRISPR seem to
         | like ending up in the liver and are hard to deliver at dose to
         | hit other organ systems. It has been one of the big struggles
         | of CRISPR companies. That being said, this is a huge deal and
         | very encouraging.
         | 
         | As to the FDA stance, it tends to be more willing to go ahead
         | with compassionate uses like this when it's clearly life or
         | death.[1]
         | 
         | [1] https://www.statnews.com/2025/05/15/crispr-gene-editing-
         | land... This discuss a little of the FDA stuff but not much
         | more detail, it sounds like they did let them skip some
         | testing.
        
       | morkalork wrote:
       | I think it was here a few years ago that I read a comment saying
       | that sick children will be the Trojan horse for normalizing gene
       | editing of humans, because who could say no to sick children,
       | right? Well, guess it's here now, so how long utill the eugenics
       | wars start?
        
         | ninetyninenine wrote:
         | [flagged]
        
           | psychoslave wrote:
           | [flagged]
        
             | NoMoreNicksLeft wrote:
             | [flagged]
        
             | ninetyninenine wrote:
             | A baby Hitler gaurantees a future with a grown up Hitler.
             | Killing the baby eliminates that future.
             | 
             | There could be other babies that can also grow up to be
             | future Hitlers. So let's say 4 such babies exist. By
             | killing one I eliminated 1/4 for futures with Grown up
             | Hitlers that exist.
             | 
             | This whole thread is getting flagged. Likely by an
             | irrational parent who can't even compute natural selection,
             | babe, and Hitler all in a single paragraph.
        
           | mckn1ght wrote:
           | I think part of the problem is that "really good" and "really
           | bad" are not universally accepted norms for any given ethical
           | question. What you're seeing is your own value system
           | assumptions being checked.
           | 
           | It's perfectly reasonable to say that while a technology has
           | the propensity to be used for evil, it also has positive
           | applications and that the real benefit now outweighs the
           | potential downside in a hypothetical future.
           | 
           | Otherwise you will go down a rabbit hole at the bottom of
           | which lies a future where we all just kinda dig in the dirt
           | with our hands until we die because every technological
           | innovation can be used in a variety of ways.
           | 
           | Like, it's silly to me that I can't bring a 1.5" blade
           | keychain utility knife on a flight, and then they hand me a
           | metal butter knife in first class. I could do way more damage
           | with that. But they allow the butter knife because the
           | utility has shown to far outweigh the potential downside that
           | hasn't manifested.
           | 
           | > I will slaughter a baby if I know for a fact that baby will
           | grow up to be the next Hitler
           | 
           | This is one of those things that is easy to say precisely due
           | to the impossibility of it ever actually becoming a real
           | decision you have to make.
        
             | ninetyninenine wrote:
             | >This is one of those things that is easy to say precisely
             | due to the impossibility of it ever actually becoming a
             | real decision you have to make.
             | 
             | It's true. But things like this should be easy to say
             | right? Like we may not be able to act logically. But we
             | should be able to think logically, communicate logically
             | and show that we are aware of what is logical.
             | 
             | My post got flagged meaning a lot of people can't separate
             | the two things. So for example I may not be able to kill
             | the baby in reality, but I can at least see how irrational
             | I am.
             | 
             | The person who flagged me likely not only can't kill the
             | baby. He has to construct an artificial reality to justify
             | why he can't kill the baby and why his decision must be
             | rational.
        
               | mckn1ght wrote:
               | I think things like that should be easy to say, if by
               | that you mean censorship. Sure. But talk is cheap. And
               | there are gradations of reality.
               | 
               | It would maybe be easier for a 15-25 y.o. to kill a baby
               | they don't know and whose parents/family they don't know,
               | and maybe even easier if they don't speak their language
               | or look like them. Of course, the baby wouldn't be the
               | only one you'd have to kill, most likely.
               | 
               | I submit that it would be _very very_ different if you
               | found out that your 4 year old child was going to go on
               | to be the next Hitler. For a  "normal" person, I think
               | they would go to the ends of the earth to try to shape
               | them into the kind of person that wouldn't do it. I think
               | very few people would coldly calculate "welp, guess I
               | gotta execute this adorable little child I've grown so
               | attached to" as it looks up at them saying "I love you so
               | much forever, mommy/daddy" with their little doe eyes.
               | 
               | (ETA: it also brings up side questions about nature vs
               | nurture and free will)
               | 
               | And then consider the lifelong repercussions of the
               | emotional fallout. You can use all the logic in the world
               | to justify the action, but your human brain will still
               | torment you over it. And likely, most of the other human
               | brains that learn about it would torment you as well.
               | 
               | ---
               | 
               | So, while I think you _can_ say things like that, ie the
               | ability and allowance, I think you should question
               | whether you _should_. I think saying those kinds of
               | things really doesn 't add much to the discussion because
               | I believe it's really just an uninformed platitude that
               | only someone with a lack of life experience would
               | believe.
               | 
               | For me this all highlights the fact that meaty ethical
               | questions don't have a simple reductive answer. Which
               | ties back in to the original problem that OP outright
               | states that this is simply and clearly the wrong path to
               | go down.
               | 
               | (PS the downvoting/flagging could be due to breaking the
               | guidelines around discussing downvotes and flags, and not
               | actually due to the topical content of the posts, and/or
               | assuming bad faith on the part of other users as such:
               | https://news.ycombinator.com/newsguidelines.html)
        
               | ninetyninenine wrote:
               | >So, while I think you can say things like that, ie the
               | ability and allowance, I think you should question
               | whether you should.
               | 
               | You should because many choice in life are not strictly
               | black and white. Saving a babies life versus introducing
               | gene editing to humanity. If there was a baby where we
               | knew he would grow up to slaughter millions it's
               | absolutely worth talking about. In the age of AI and gene
               | editing where things are influencing what it even means
               | to be human, it is wise to stop and pause for a minute to
               | ask the right question rather then charge forward with
               | change that can't be taken back all because we wanted to
               | save a baby.
        
           | cooper_ganglia wrote:
           | The anti-eugenics guy just said he would "absolutely" murder
           | a baby...?
        
             | ninetyninenine wrote:
             | I would if I can foresee the future. But with eugenics you
             | can't foresee the future. Self artificially selecting for
             | genetic traits doesn't guarantee a good future. There's no
             | gene for recreating Hitler either.
        
         | dekhn wrote:
         | it's unclear the outcome of this will be eugenics wars.
         | 
         | Answering the real question- it's unlikely these techniques
         | will see widespread "recreational" usage any time soon, as they
         | come with a wide range of risks. Further, the scientific
         | community has learned a lot from previous eugenics programs;
         | anything that happens in the future will happen with both
         | social and political regulation.
         | 
         | It's ultimately hard to predict- many science fiction writers
         | have speculated about this for some time, and social opinion
         | can change quickly when people see new developments.
        
           | NoMoreNicksLeft wrote:
           | The problem won't be that there will be those who want to
           | have babies with edited genomes, and those who oppose that.
           | 
           | It will be that people just don't have children at all.
        
             | beeflet wrote:
             | I think one reason why people won't have children is the
             | gene-editing and the IVF that is coming. Nothing is left to
             | chance, or to god any more. Having children is now a
             | clinical affair. It's spiritually void.
        
           | morkalork wrote:
           | That's part of why the trojan horse works so well, what is an
           | unacceptable risk for someone healthy can easily be
           | acceptable for someone with an otherwise untreatable
           | condition. Then by the experience and knowledge gained, it
           | becomes less risky for everyone.
        
         | jjcob wrote:
         | It's not a slippery slope. Fixing defects is rather
         | straightforward, since it's usually a single gene that needs to
         | be edited.
         | 
         | If you want make your baby smarter, taller, or more handsome,
         | it's not so easy because these traits involve 1000s of genes.
         | 
         | For this reason I do not think that curying diseases will lead
         | to designer babies.
        
           | GenshoTikamura wrote:
           | You're certaily unfamiliar with the term "incrementalism" and
           | its workings
        
             | tptacek wrote:
             | No, you're assuming that polygenic trait control "scales"
             | like a sort or even a search algorithm, when there's some
             | molecular genetic evidence that it may instead scale like a
             | cipher key size.
        
           | sfink wrote:
           | If you can affect germline cells, then I don't see how it's
           | not a slippery slope. (I'm not arguing against doing it, just
           | that it is a slope and the slope is slippery.) No designer
           | babies necessary.
           | 
           | I'll steelman "fixing defects" by sticking to serious
           | hereditary diseases (and yes, only those that correspond to
           | one or a few known genes). As more and more conditions become
           | treatable, the population with access to resources will have
           | lower healthcare costs by being less susceptible to problems.
           | (Which is a good thing, note!) Insurance companies will have
           | more and more proxies for differentiating that don't involve
           | direct genetic information. Societally, "those people" [the
           | poor and therefore untreated] cost more to support medically
           | and are an increasing burden on the system. Eugenics gains a
           | scientific basis. Do you want your daughter marrying someone
           | genetically substandard, if you don't have the resources to
           | correct any issues that might show up? Probably not, you're
           | more likely to want to build a wall between you and them.
           | Then throw over anyone who falls behind the bleeding edge of
           | corrections.
           | 
           | It'll be the latest form of redlining, but this time "red"
           | refers literally to blood.
        
             | mckn1ght wrote:
             | I'm a fan of saying there's always a slippery slope, it's
             | just a matter of the parameters.
             | 
             | But, I think that it's misguided to apply the human problem
             | of othering to a given technology. Regardless of technology
             | X, humans are gonna human. So, if X helps some people, we
             | should consider it on that basis. Because without X, we
             | will still have an endless stream of other reasons to draw
             | red lines, as you allude to. Except in addition we'll also
             | still have the problem that X could've helped solve.
             | 
             | If gene editing to cure diseases leads to a future where
             | people want to shunt off the poor that are now the outsized
             | burden of the healthcare system, the answer from where I
             | sit is to find ways to make the gene therapies available to
             | them, not to cart them off to concentration camps while
             | they await extermination. This will require all the
             | trappings of human coordination we've always had.
             | 
             | Preventing X from ever coming to fruition doesn't at all
             | prevent all possible futures where concentration death
             | camps are a possibility. To me they are orthogonal
             | concerns.
             | 
             | Even if you can convince one culture/society not to do it,
             | how do you stop others? Force? Now you have a different
             | manifestation of the same problem to solve. Society needs
             | to learn how to "yes, and..." more when it comes to this
             | stuff. Otherwise, it's just war all the way down.
        
               | sfink wrote:
               | I mostly agree. Well:
               | 
               | > This will require all the trappings of human
               | coordination we've always had.
               | 
               | It is also true to say that we've never had it as quickly
               | as it has been needed, and neither is it done as well as
               | it needs to be. We will blunder into things that are easy
               | to predict in advance if we are willing to look and
               | accept what we see, but we won't.
               | 
               | I absolutely agree that this advance is a great thing and
               | should be pursued further. But I also think that simply
               | categorizing it as good or bad is a way to willfully
               | ignore the unintended consequences. We should at least
               | try to do better.
               | 
               | > Society needs to learn how to "yes, and..." more when
               | it comes to this stuff.
               | 
               | Absolutely. I just think that requires nuance, wide open
               | eyes, and acceptance of uncomfortable truths. Part of the
               | nuance is not boiling it down to a yes/no question of
               | "should this proceed?" (For example, how about: "How can
               | we utilize these new capabilities to maximize benefit and
               | minimize harm, when the only real lever we seem to have
               | to work with is the profit motive? Everything else is
               | getting undermined in its service.")
        
           | beeflet wrote:
           | >For this reason I do not think that curying diseases will
           | lead to designer babies.
           | 
           | Well, you're wrong. Where is the line drawn for what
           | constitutes a disease? Retardation? Autism? Eventually every
           | child below, say, 130 IQ will be considered disabled and
           | unable to find work.
           | 
           | Apply this to every other trait: cardiovascular health,
           | strength, height, vision, etc. All forms of weakness can be
           | considered a disease. The end product of eugenics is that
           | mankind will be made into a docile and fragile monoculture.
           | 
           | >If you want make your baby smarter, taller, or more
           | handsome, it's not so easy because these traits involve 1000s
           | of genes.
           | 
           | And? it's obvious that the technology will eventually be
           | capable of this, just not all at once. It starts with single-
           | gene mutations, then it will be 10's of genes, and then
           | hundreds and thousands.
           | 
           | That is the slippery slope: there is absolutely nothing about
           | your reasoning that prevents one step from leading to
           | another.
        
             | tptacek wrote:
             | He wasn't saying that curing diseases wouldn't lead to
             | designer babies because he objects to the idea (though he
             | might). He's saying that the factors that lead to a "130
             | IQ" score are, to the extent that they're causatively
             | genetic at all, highly polygenic. Molecular genetics
             | results aren't putting us on a track to predict polygenic
             | behavioral traits (I guess except smoking?), let alone
             | control them.
             | 
             | It's helpful to evaluate claims on this thread in the
             | context of the story. It's possible (though still a very
             | open question) that complex behavioral traits will
             | generally become predictable or maybe even controllable in
             | the future. But those would require breakthroughs
             | (including basic science discoveries breaking in the
             | direction baby-designers want them to) _more significant_
             | than the announcement on this story.
        
             | stereolambda wrote:
             | Honestly to me inequality has been always the main
             | reasonable angle of attacking gene editing. But if vaccines
             | are an analogy, many countries were eventually able to mass
             | vaccinate for dangerous diseases. So this could be only the
             | question of cost, after some period of only elite
             | availability.
             | 
             | There's no inherent metaphysical worth in being on any
             | particular level of strength, height etc., so we can spread
             | whatever is the most convenient. I think arguments against
             | (that I see being made) ultimately devolve into some
             | magical thinking and _a priori thing bad_. (I am glad to be
             | shown otherwise.) In fact we are already messing with human
             | fertility in possibly unsustainable ways, so maybe more
             | tools are needed as a part of the way out.
             | 
             | Of course there is political execution, corruption etc.,
             | but I don't see it any different from other technological
             | challenges that civilization has dealt with. I.e. we need
             | better politics but the tech is not at fault. Gene editing
             | is isolated interventions, so it's in that detail more
             | manageable than for example mass surveillance which is
             | hidden and continuous.
             | 
             | One more esoteric argument is that we cannot socially agree
             | on what traits are desirable. The 'The Twenty-first Voyage
             | of Ijon Tichy' scenario. So opposite to "monoculture" in a
             | way. But I don't see people expanding on that.
        
         | ysofunny wrote:
         | I think i'm fighting on those wars right now, you can also call
         | them 'darwin wars' i suppose... but bear in mind i'm crazy and
         | online
        
         | protocolture wrote:
         | Well a sick child has been healed so that necessarily means we
         | will have a war about it?
        
         | danielodievich wrote:
         | For a nice thoughtful imagination of said future, Nancy Kress's
         | Beggars in Spain https://en.wikipedia.org/wiki/Beggars_in_Spain
         | suggests one possible outcome. It has both gene editing to make
         | better humans and unproductive masses. A short yet powerful
         | read.
        
         | WorldPeas wrote:
         | Not to argue semantics here but eugenics is arround selective
         | breeding, this would allow for the opposite, even more
         | breeding, especially in populations with hereditary ailments
         | that would have refrained from the act in prior years. I do
         | agree however that it is imperative greater common-sense
         | regulations surrounding "aesthetic" or "performance"
         | "modifications" (such callous words for young life) will need
         | to be enacted.
        
       | ecshafer wrote:
       | As a father, the idea of being told my 1 week old baby is going
       | to die would be my worst nightmare. The fact these doctors and
       | scientists saved this childs life is a monument to modern medical
       | science. This is absolutely insane. Hopefully the child doesnt
       | need a liver transplant, but this is a great leap forward.
        
       | javiramos wrote:
       | Research funded by the NIH which our government is actively
       | gutting
        
         | jmcgough wrote:
         | Yep, this effort is the culmination of 50 years of research.
         | Could be the last harrah of the NIH with the amount of cuts
         | we've had and the scientists who are taking jobs in other
         | countries.
        
           | declan_roberts wrote:
           | Unfortunately a staggering amount of research in other
           | countries is largely funded by the NIH/USA.
        
             | thrance wrote:
             | How so?
        
             | jordanpg wrote:
             | And so what?
        
               | lenerdenator wrote:
               | That means that it's not going to happen anymore.
               | 
               | Unless those other countries step up and fund it
               | themselves.
               | 
               | They might. They might not.
        
               | mmooss wrote:
               | Indeed - does it matter who performed the research? If
               | the CRISPR reasearch were performed in another country,
               | would that change the outcome for the infant?
        
               | lentil_soup wrote:
               | It was indeed researched by a combination of countries
               | and institutions
        
             | biofox wrote:
             | And those grant awards need to demonstrate how they benefit
             | the USA. Many are (were) related to disease surveillance in
             | developing countries to prevent pandemics, or
             | collaborations with countries that are more advanced than
             | the US in niche areas.
        
             | lentil_soup wrote:
             | What a shortsighted view.
             | 
             | The technology used on this same article was funded by Max
             | Planck (Germany), Sweden and the NIH to a french and a USA
             | scientist. Should those collaborations stop?
        
             | nopakos wrote:
             | That may be partially true, but it's also important to
             | understand that the US benefited a lot from that.
             | Scientists from all over the world moved to work in the US,
             | students looked forward to studying there and working in US
             | companies, etc.
             | 
             | That is changing. Children in my country are moving from
             | learning English to French and German in order to study in
             | European universities. This started after Brexit and will
             | accelerate now.
        
             | anarticle wrote:
             | The reason for this is very pragmatic actually. We don't
             | have enough researchers of a particular specialty in one
             | country alone. When you get that specialized the air is
             | very rare.
             | 
             | By pooling our funding / effort we can create a larger body
             | of collaborators to solve problems faster and better.
             | 
             | It could be that the organizations are funding wild stuff
             | that isn't salient. I'll concede that.
             | 
             | However, in basic sciences there are so few specialists it
             | is important to share resources. The funding is worse than
             | ever (hello 2006!), and that trend is unlikely to reverse
             | for a while.
             | 
             | Source: I worked in bioenergetics for 10y, my collaborators
             | were from Hungary, Chile, Canada, Israel, Italy, and more!
             | At a major conference on mito energetics they all fit in
             | one big lecture hall (100ish?)
        
             | insane_dreamer wrote:
             | Terrible take. Do all scientists who make breakthroughs
             | that we might benefit from live in the US? CRISPR itself
             | was a US-German collaboration.
        
         | julienchastang wrote:
         | Not to mention the long arcs of the careers of scientists and
         | support staff involved in this breakthrough, who were also
         | supported by federally funded research grants.
        
           | dylan604 wrote:
           | Interesting view as many people were so anti-MRNA vaccine
           | because "it was created too fast" oblivious to the
           | years/decades of study in that field that allowed for that
           | "too fast" to happen.
           | 
           | I guess it's still too early in this story's news cycle for
           | the people with anti-views to be making noise yet. No GMOs,
           | but human gene modification is okay. No cloning either. The
           | boogeyman is gonna get us no matter what we do
        
         | jordanpg wrote:
         | As the father of a 5 year old boy with a genetic degenerative
         | muscular disease whose lifespan will depend directly on how
         | fast these technologies progress, I have difficulty responding
         | in a civilized manner to the pointless, cruel, and stupid
         | actions of the Administration in this regard. Rage is the word.
         | 
         | It is breathtaking to consider how the members of the
         | Administration and their children, parents, and grandparents
         | have benefited from NIH-funded research in innumerable ways
         | that they are shamefully unaware of, every time they visit the
         | doctor or the ER.
        
           | epistasis wrote:
           | I have the same rage. But it extends equally to those who
           | voted them in and donated to their campaigns, including my
           | own family members.
           | 
           | They have created a huge rift in this country and I am still
           | trying to figure out if I will forgive my family members and
           | what they'd have to do to set us on a path towards
           | reconciliation.
           | 
           | When there's a contract in place to conduct pediatric cancer
           | research, and the government decides one day to break that
           | contract, and it takes courts to rectify the situation, and
           | then the government defies the courts, and the voters are
           | cheering on the illegal actions of the politicians, well,
           | rage is a mild word for what I feel.
        
             | amendegree wrote:
             | The complete lack of self awareness is always breathtaking.
             | Demanding empathy from others while being completely
             | incapable of it yourself is always a stunning thing to
             | encounter.
        
               | thrance wrote:
               | Do not mistake legitimate grievances for a lack of
               | empathy. It's entirely on republicans to stop being so
               | racist and vile to recover the rest of the population's
               | respect.
               | 
               | See also: the paradox of intolerance.
        
         | thuanao wrote:
         | Government? Republicans. _Republicans_ are the ones fighting
         | against government funded research. Let's put blame where blame
         | belongs.
        
         | 3D30497420 wrote:
         | Also, several of the key doctors and researchers were not born
         | in the US. I'm sure plenty of researchers are now thinking
         | twice about working in or moving to the US.
         | 
         | Edit: Still reading the article, but so far researchers working
         | in the US have come from India, Russia, born to Taiwanese
         | immigrants, and more.
        
       | throw7 wrote:
       | Gattaca here we come!
        
         | GenshoTikamura wrote:
         | One can not simply raise valid concerns about gene editing
         | technologies in the hands of the entities that don't hesitate
         | sending people en masse to kill and die and otherwise manifest
         | their fascist cravings in the open, here on HN and walk away
         | undownvoted
        
           | kubb wrote:
           | Science fiction pattern matching is a problem nobody talks
           | about. People see something that vaguely resembles a movie
           | that they saw and act like that movie is reality now.
        
             | GenshoTikamura wrote:
             | Another problem nobody talks about is the cognitive
             | dissonance of living in the world today but dismissing all
             | matching patterns as science fiction or conspiracy
             | theories. Maybe narrow focus and short attention span are
             | to blame
        
               | kubb wrote:
               | When someone tells you they know how the future plays out
               | because they saw it in fiction, oh boy you better be
               | skeptical.
        
               | goda90 wrote:
               | Maybe they are actually saying "we should take steps to
               | avoid possible futures that we've already established
               | would be bad in our works of art". You can't just hand
               | wave away the idea that some technology could allow for
               | greater invasion of privacy and worse social
               | stratification when we still live in a world where
               | invasion of privacy and social stratification actively
               | occur.
        
         | sfink wrote:
         | There is a strong hunger for Gattaca.
         | 
         | Heck, if parents could provide a trust fund for their kids in a
         | way that their kids couldn't piss it away, they'd be all over
         | it. (I'm sure this exists to varying degrees.)
         | 
         | Look at what wealthy parents already do to get their kids into
         | colleges or out of jail. I think it's ridiculously naive to
         | think that we parents wouldn't jump at the chance to write
         | generational wealth into our kids' genes.
         | 
         | (This is not an argument that developing this capability is a
         | bad thing and should be stopped.)
        
         | Joel_Mckay wrote:
         | Fertility care often already included testing for common
         | genetic disorders, and parents with a history of severe disease
         | would often make the hard choice to try again. Due to recent
         | Theocratic political shifts, it means more families will face
         | the worst possible life for their children.
         | 
         | Gattaca was a film years ahead of its time, and raises the
         | question of what happens when people try to "fix" human beings
         | beyond disease prevention. A subtle, but important ethical
         | difference. =3
        
           | im3w1l wrote:
           | Disease is fuzzy word, it basically means below some made up
           | bar for healthiness. Take dyslexia as a simple example. That
           | disease can by definition not exist in an illiterate
           | population. We have raised the bar and now they are diseased
           | in need for a cure.
           | 
           | The more we things we cure the higher we will reach and the
           | higher we reach the higher we will raise the bar. I don't
           | think that's a bad thing, but its worth bearing in mind.
        
             | Joel_Mckay wrote:
             | Various learning challenges would fall outside a lifetime
             | of suffering, and often such kids have statistically higher
             | IQ. ;)
             | 
             | I think it is more likely people will create synthetic
             | diseases by experimenting on human beings with unique
             | unpredictable gene expression.
             | 
             | He Jiankui already crossed the ethical boundary in 2018...
             | only to discover his best intentions were still nonsense.
             | The GMO kids he helped edit will have a lifetime to figure
             | out if that alteration negatively affected them, and as
             | adults consider how their own children may change.
             | 
             | People may cross the "Primum non nocere" line, but it can
             | never ethically be justified =3
        
           | goda90 wrote:
           | I'd say Gattaca touches on how easy it is to edge a little
           | over the line of what is a "disease". For example this scene
           | touches on "prejudicial conditions" like baldness:
           | https://www.youtube.com/watch?v=pCN5QG8Jtwg
        
       | Traubenfuchs wrote:
       | Are the edited genes inherited, or the original ones? Does the
       | previous question have an answer that depends on the babies sex?
       | 
       | From an evolutionary perspective it's interesting how the further
       | medicine gets, the more we inherit genes unfit for life without
       | medical support.
        
         | breakyerself wrote:
         | I'm sure we'll be editing these diseases out of the germ line
         | at the same time in the not too distant future.
        
           | EvanAnderson wrote:
           | Speaking as a person whose friend died at 21 from
           | complications related to cystic fibrosis I would like to see
           | these diseases edited out of the germ line.
        
         | Balgair wrote:
         | No, it's only in the liver, from what I can tell from the
         | science, not the gametes.
         | 
         | No, it would not depend on the sex of the baby, as the
         | chromosomes that you're editing aren't X or Y.
         | 
         | Evolutionarily, the inheritance of genes is a far slower
         | process than the medical advancements we make, so what I think
         | we're seeing here is a chasing down of the low probability
         | events. In that, most of the evolutionary pressure is coming
         | from things like dirty water and bad food, but as we're solving
         | those low hanging fruit, we have to go to lower probability
         | events to make progress that feels equally important.
         | 
         | Also, if I am wrong here on the answers to the questions,
         | please correct me!
        
           | dekhn wrote:
           | If they could get complete delivery to the liver stem cells,
           | then the change could be permanent, although this is making
           | many simplifications.
           | 
           | Organs in your body usually keep some very old cells (formed
           | in the embryo) around which act as parents for all the new
           | cells in an organ. Any cell can only divide a limited number
           | of times, so they typically maintain a "tree structure" where
           | the old cells create children and grandchildren (etc) that
           | then differentiate into the organ-specific cells that do the
           | actual organ work.
           | 
           | If you modify only the differentiated cells, eventually they
           | die, and are replaced by descendents of stem cells; if those
           | stem cells didn't get modified, their descendents will not
           | have the fix, and the treatment efficacy reduces over time.
        
             | Traubenfuchs wrote:
             | That's what I was asking: Baby females already have all the
             | eggs they will ever have once they are born, right?
             | Matryoshka doll style. While sperm is always (relatively)
             | fresh.
        
             | something098 wrote:
             | Both eggs and sperm producing cells are created during
             | formation of embrio. We could even define that these cells
             | as "clones of you" that were created not much after your
             | first cells were created, because your DNA, that undergoes
             | changes in your organism is never given to your offsprings
             | - it is DNA of your "clone" cells. Eggs are as you have
             | defined - "very old cells". Most probably cells that are
             | producing sperm also can be defined as "very old cells" as
             | most probably sperm production does not function the same
             | way as other cells, that are staying in organism and
             | accumulate mutations.
             | 
             | Stem cells from other organs has absolutelly nothing to do
             | with this. Unless you are refering to procedures of
             | planting stem cells from one organ to another to help
             | failing organ, as stem cells are universal cells, that are
             | able to produce cells for any organ.
        
         | thrance wrote:
         | Is the global gene pool actually degrading though? I only ever
         | hear that in thinly veiled attempts at advocating for
         | eugenicism. And it never comes substantiated by any research.
         | 
         | Anyway, this baby proves we can fix hereditary diseases now.
        
           | Traubenfuchs wrote:
           | > eugenicism
           | 
           | That comes in many forms:
           | 
           | Black/dark one, nazi style, where you outright sterilise or
           | even kill those with unhealthy/bad genes.
           | 
           | And white/peaceful one, where you'd appeal to those with
           | unhealthy/bad genes not to procreate and encourage those with
           | healthy/good ones to do.
           | 
           | You can't seriously tell me it's not extremely unethical for
           | people with huntington's disease or cystic fibrosis to have
           | children.
        
             | something098 wrote:
             | The issue here is that with this approach we have to ask
             | who has to be limited next. Especially if you get older...
             | 
             | >>>You can't seriously tell me it's not extremely unethical
             | for people with huntington's disease or cystic fibrosis to
             | have children. Don't flatter yourself - your genes are
             | basic and ridddled with bad genes. You do not know what
             | time bomb you are carying in your DNA.
             | 
             | The solution that you are offering is quite simple -
             | procreate early as possible and die not in old age and
             | voila - there are no issues in more than 99.99% cases. But
             | something tells me that you are already older than healthy
             | monkey and do not plan to live in a tree - your bones are
             | too old for that and thanks to evolution are not meant for
             | that.
             | 
             | Evolution of humans in future includes even longer lifespan
             | which naturally comes with children produced at much later
             | age than we do now and that comes with diseases to be dealt
             | with, as that is part of evolution. We do not know much
             | about mutations in DNA - they are never good or bad - they
             | are combinations of something. For example - diabetes type
             | 2 seems to be from genes, that allowed humans to survive
             | hunger for long period of time - are those genes bad,
             | because people are obese nowadays? As for mentioned
             | diseases - we value other humans not by DNA, but what they
             | are to us. You would sing a different song, when their
             | offspring would have any of such disease and you are in
             | luck and not planning to have any.
        
             | Cthulhu_ wrote:
             | Most genetic diseases only occur when two parents happen to
             | have it, but they won't necessarily be aware of it; would
             | it be unethical for people who are unaware of their genetic
             | defects to have children?
             | 
             | Second, according to a quick search, 10% of cases of
             | Huntington's Disease are due to new mutations; I suspect
             | (but I'm a HN commenter, no geneticist) this is the case
             | for many other genetic conditions.
             | 
             | So the other ethics question to ask: should people be able
             | to get DNA tests for genetic conditions (voluntary)? I'd
             | say yes. Should people be mandated to get DNA tests and be
             | forbidden to procreate if there's something in there? No,
             | that's eugenics. Should people who know they have a genetic
             | condition and there's a chance their child has it too have
             | children? That'd be their choice. I don't think it's fair
             | for people to intentionally place a burden on health care
             | systems like that, but thing is, there's very, very few
             | people that have children with that as the intent.
        
         | lawlessone wrote:
         | couldn't be unless they reached reproductive cells.
        
       | bilekas wrote:
       | > But KJ's treatment -- which built on decades of federally
       | funded research -- offers a new path for companies to develop
       | personalized treatments without going through years of expensive
       | development and testing.
       | 
       | Really incredible story and I'd love to know the process for
       | receiving this, for example FDA approval etc. It's nice to see
       | such in-your-face results from Federal funding programs. Without
       | being political, it's sometimes hard for regular people to
       | appreciate just how much good actually comes out of Federal
       | Funding. There was another thread where someone even said
       | something along the lines of : "Well during war things get done
       | faster" . This simply isn't true. It might be done louder but
       | Federal Funding never stopped pushing things forward.
        
         | baxtr wrote:
         | Now imagine DOGE team of experts cutting this a couple of years
         | ago
        
           | bilekas wrote:
           | I didn't want to bring up specifics but I'd be lying if it
           | wasn't on my mind.
        
             | shadowgovt wrote:
             | It would probably be good if more of us brought up
             | specifics more often.
        
               | bilekas wrote:
               | It would be nice, but you know how politics can usually
               | turn into a bit of a toxic environment online. That said,
               | I personally don't see the DOGE thing as anything other
               | than a way to reduce the power of regulatory enforcement.
               | I'm sure someone who would want that would never be
               | conflicted with interests there...
        
             | munificent wrote:
             | I mean, the article is explicitly written to put it on your
             | mind:
             | 
             | "The implications of the treatment go far beyond treating
             | KJ, said Dr. Peter Marks, _who was the Food and Drug
             | Administration official overseeing gene-therapy regulation
             | until he recently resigned over disagreements with Robert
             | F. Kennedy Jr., the secretary of health and human
             | services_. "
             | 
             | "But KJ's treatment -- which built on decades of federally
             | funded research"
             | 
             | "The result "is a triumph for the American peoples'
             | investment in biomedical research," Dr. Urnov said."
             | 
             | "The researchers emphasized the role government funding
             | played in the development."
             | 
             | "The work, they said, began decades ago with federal
             | funding for basic research on bacterial immune systems.
             | That led eventually, with more federal support, to the
             | discovery of CRISPR. Federal investment in sequencing the
             | human genome made it possible to identify KJ's mutation.
             | U.S. funding supported Dr. Liu's lab and its editing
             | discovery. A federal program to study gene editing
             | supported Dr. Musunuru's research. Going along in parallel
             | was federally funded work that led to an understanding of
             | KJ's disease."
             | 
             | ""I don't think this could have happened in any country
             | other than the U.S.," Dr. Urnov said."
             | 
             | This is an article about federal funding of medical
             | research with a cute baby as the human interest bit.
        
           | 0_____0 wrote:
           | Here's the thing - likely few would have noticed. We are
           | structurally blind to the places in which public investment
           | would have made our lives better, especially when they are
           | things like scientific research that the vast majority never
           | think about until it produces results.
        
         | jjeaff wrote:
         | I'm not an expert, but I have learned that FDA approval is not
         | actually necessary for treatments and drugs. Your doctor has a
         | lot of leeway when it comes to treatment but she of course
         | experiences more risk of accusations of malpractice when
         | prescribing off label drugs or unapproved treatments. insurance
         | will also rarely cover treatment that is not FDA approved. the
         | requirement for FDA approval generally has more to do with your
         | legal ability to market the drug, treatment, or product.
        
           | bilekas wrote:
           | That's actually super interesting and kinda great to hear, I
           | guess my follow up question is obvious but would insurance
           | companies cover that kind of procedure in the US? I get the
           | impression it wouldn't be.. but if out of pocket.. I know I'd
           | absolutely do anything for my kid.
        
         | tempaway43563 wrote:
         | they were able to develop the treatment and fast track it
         | through the FDA in six months, details in this write-up
         | 
         | https://innovativegenomics.org/news/first-patient-treated-wi...
        
       | efilife wrote:
       | [flagged]
        
         | foxglacier wrote:
         | If you're being pedantic, babies usually never die - they
         | transform into an adult which is the form that dies.
        
         | blacksmith_tb wrote:
         | Typically yes? But surviving infancy is the first step on the
         | road to immortality (but that will require more than CRISPR...
         | probably?)
        
           | 331c8c71 wrote:
           | Immortality? (rolleyes)
        
         | bigs wrote:
         | Hopefully after living a long and fulfilling life? Geez
        
         | morepedantic wrote:
         | Edgy! No one has ever considered the mortality of their
         | children ever, or contemplated the difference between death
         | before and after the realization of potential. Wow!
        
           | efilife wrote:
           | Genuinely don't know why this is edgy. I was trying to
           | understand his logic
        
             | cluse wrote:
             | Having a child predecease you is one of the worst things
             | that can happen to a person in general. This is a common
             | sentiment in humans. The strange thing is that you
             | mentioned you're trying to follow "logic." This is not
             | logic. These are emotions.
        
               | efilife wrote:
               | I understand this. My question arose from the fact that
               | it seems like he only cares about the child dying before
               | him, not the child's death overall. It was
               | 
               | > the idea of being told my 1 week old baby is going to
               | die
               | 
               | not
               | 
               | > the idea of my child dying
        
               | viewtransform wrote:
               | "I am simply a machine. I do not experience death as
               | humans do. It is just a cessation of function." - Data in
               | Star Trek The Next Generation,
        
               | philsnow wrote:
               | It's less of
               | 
               | > my baby is going to die, woe is me
               | 
               | and more of
               | 
               | > have I failed my baby so much as a parent that he won't
               | even grow to adulthood (much less have a wonderful, happy
               | life)
               | 
               | It's not exactly a rational feeling; it's not like this
               | baby was going to die through lack of parental effort or
               | care or anything else that the parents have any real
               | control over, so it's not like they could have done
               | anything differently.
               | 
               | Nonetheless, it can make you feel like an utter failure
               | of a parent. To some people (I admit, not everybody),
               | that is absolutely _crushing_.
        
         | bloomingeek wrote:
         | Not only a hurtful question, but a stupid one as well. Well
         | done.
        
           | efilife wrote:
           | Care to explain why it is stupid? And what's hurtful about
           | it, too? Deciding on a child, you KNOW it's going to day at
           | some point
        
             | tombert wrote:
             | I don't really know what you're going on about? We're all
             | going to die, we all know that that's going to happen, but
             | none of us want to suffer and most of us would like to live
             | relatively long lives.
             | 
             | I am not a parent but I think if I did have a kid I would
             | try everything I could to keep my child alive and minimize
             | pain in my child's life.
        
         | koala_man wrote:
         | [flagged]
        
           | sedatk wrote:
           | Only 1% of the population has autism. Presenting autism as a
           | considerable possibility for trollish behavior isn't much
           | different than what the parent commenter did.
        
             | efilife wrote:
             | [flagged]
        
               | sedatk wrote:
               | now, confirmed.
        
           | concordDance wrote:
           | What was the question? The rampant flagging here is quite
           | annoying.
        
             | efilife wrote:
             | My original comment said:
             | 
             | > But your child will die and that's a fact. Is it only ok
             | for it to die after you?
        
               | imacomputertoo wrote:
               | Is there more context to this question? I couldn't read
               | the article because of the pay wall. But in isolation,
               | this is a dumb question. All decent parents want their
               | child to live as long as possible and be as healthy as
               | possible. Is there something deeper you were trying to
               | get at?
        
           | tomhow wrote:
           | Please don't comment like this, no matter how bad the comment
           | you're replying to. The guidelines apply to everyone equally:
           | 
           | https://news.ycombinator.com/newsguidelines.html
        
             | koala_man wrote:
             | My bad. I had been reading about how there's a frustration
             | in the community that allistic people refuse to explain why
             | such statements are wrong, and instead just repeat "you
             | know what you did!" to people who genuinely don't.
             | 
             | I tried to be the one who didn't do that, but missed the
             | mark. I'd delete it if I could.
        
         | tomhow wrote:
         | We detached this comment from
         | https://news.ycombinator.com/item?id=43998721 and marked it off
         | topic.
         | 
         | Please observe the guidelines, especially these ones:
         | 
         | Be kind. Don't be snarky. Converse curiously; don't cross-
         | examine. Edit out swipes.
         | 
         | Comments should get more thoughtful and substantive, not less,
         | as a topic gets more divisive.
         | 
         | Please don't fulminate. Please don't sneer, including at the
         | rest of the community.
         | 
         | Please respond to the strongest plausible interpretation of
         | what someone says, not a weaker one that's easier to criticize.
         | Assume good faith.
         | 
         | Eschew flamebait. Avoid generic tangents. Omit internet tropes.
         | 
         | Please don't use Hacker News for political or ideological
         | battle. It tramples curiosity.
         | 
         | https://news.ycombinator.com/newsguidelines.html
        
       | foxglacier wrote:
       | I wonder if this also affects germline cells so he won't pass the
       | same disease on to his children. If it does, that would be a
       | complete departure from almost all medical treatments we use
       | because most of them are just compensating for the effects of bad
       | genes and leaving them in the gene pool to degrade the health of
       | future generations.
        
       | ufmace wrote:
       | Did you mean to post the same link for both?
        
         | codeulike wrote:
         | Its not the same
        
       | thomasjudge wrote:
       | Can you imagine the emotional rollercoaster of this for the
       | parents
        
       | alexashka wrote:
       | [flagged]
        
         | silver_silver wrote:
         | What an insanely callous and shallow take. I don't even know
         | where to start. You're trying to claim the moral high ground by
         | complaining that a privileged child didn't suffer and die? Do
         | you even understand the point of reducing poverty?
        
           | cayley_graph wrote:
           | An absolutely terrible and tone-deaf way to phrase that
           | thought, but the fact of the matter is that most of the world
           | (you and I included, in all likelihood) will not get access
           | to this sort of thing in our lifetimes. Not because modern
           | medicine won't have been there yet, but because our lives
           | (and those of our children) are simply seen as being worth
           | significantly less than a rich person's desire to become
           | richer.
           | 
           | How many people can even afford to get multiple opinions for
           | a weird lump on their back? Or go to the dentist for a
           | strange toothache? How many people can afford to get
           | consistent exercise and eat healthy? How many lives would be
           | saved or at least massively bettered? We _already have the
           | means_ to extend the life expectancy of the average person,
           | and it 's not being used. Obviously this is a wonderful
           | medical advance, but it's depressing to wonder who it's for.
        
             | piloto_ciego wrote:
             | So obviously we should not be excited about it? Lose me
             | with that noise.
        
               | cayley_graph wrote:
               | Do point out where that was said, and I will be happy to
               | correct it! It's important to have nuanced opinions and
               | discussions about things.
        
             | squigz wrote:
             | > An absolutely terrible and tone-deaf way to phrase that
             | thought, but the fact of the matter is that most of the
             | world (you and I included, in all likelihood) will not get
             | access to this sort of thing in our lifetimes. Not because
             | modern medicine won't have been there yet, but because our
             | lives (and those of our children) are simply seen as being
             | worth significantly less than a rich person's desire to
             | become richer.
             | 
             | I'm as negative about the rich and powerful as anyone but
             | this is such a cynical take - that might have been applied
             | to many medical treatments in the past that have become
             | relatively commonplace and easily accessible to people of
             | all classes, at least in sane countries with sane
             | healthcare systems.
        
               | cayley_graph wrote:
               | Indeed, my view is heavily American-centric. And the
               | trends of the past-- which you're right about-- may not
               | apply to the future given increasing wealth inequality,
               | the cost-of-living crisis, and the climate crisis (for
               | which undoubtedly the poorest of us will be forced to
               | shoulder most of the burden).
               | 
               | I'm explicitly not saying this work shouldn't be done, it
               | should! But it does not exist in a vacuum, and it would
               | be silly to pretend that it is not colored by vastly
               | unequal access to modern healthcare. The reason I get
               | excited about technology is because of the potential it
               | holds for making us all happier and freer to do the
               | things we like for longer. We are lost if we do not at
               | least speak about the thunderclouds on the horizon for
               | this philosophy of technology.
        
               | squigz wrote:
               | > We are lost if we do not at least speak about the
               | thunderclouds on the horizon for this philosophy of
               | technology.
               | 
               | I think, every once in a while, it's okay to just
               | celebrate without looking for the the clouds :)
        
               | cayley_graph wrote:
               | That's fair, I respect that view. :)
        
             | casey2 wrote:
             | What are you talking about? Since the 1800s people have
             | been shipping vaccines to "most of the world"
             | 
             | Everyone could afford to "eat healthy" and get exercise if
             | governments and social planners put in a modicum of effort.
             | Unfortunately they aren't directly incentives to do so.
             | 
             | Framing either of these things as a wealth issue ignores
             | both how wealthy even the poorest in the world are and the
             | systems responsible for the problem. For everything else
             | there's health insurance, yet another horribly mismanaged
             | system.
        
         | tomhow wrote:
         | We detached this comment from
         | https://news.ycombinator.com/item?id=43998721 and marked it off
         | topic.
         | 
         | Please observe the guidelines, especially these ones:
         | 
         |  _Be kind. Don 't be snarky. Converse curiously; don't cross-
         | examine. Edit out swipes._
         | 
         |  _Comments should get more thoughtful and substantive, not
         | less, as a topic gets more divisive._
         | 
         |  _Please don 't fulminate. Please don't sneer, including at the
         | rest of the community._
         | 
         |  _Please respond to the strongest plausible interpretation of
         | what someone says, not a weaker one that 's easier to
         | criticize. Assume good faith._
         | 
         |  _Eschew flamebait. Avoid generic tangents. Omit internet
         | tropes._
         | 
         |  _Please don 't use Hacker News for political or ideological
         | battle. It tramples curiosity._
         | 
         | https://news.ycombinator.com/newsguidelines.html
        
           | alexashka wrote:
           | [flagged]
        
       | danielodievich wrote:
       | When my second son was born and was just so very tiny some
       | genetic test came out questionable. We were very strongly
       | encouraged to go to Childrens hospital ASAP to get more tests. He
       | handled it well, being just a few weeks old. The tests came with
       | "he's a carrier of something obscure but nothing to worry about",
       | so it's all forgotten.
       | 
       | Three interesting thing come out of it from me. First, I was on
       | Microsoft insurance which was quite gold plated at a time, a
       | blessing only obvious in rear-view mirror, because Childrens was
       | quite excited to continue any number of tests. Second, the
       | technology of all this is absolutely amazing and I am so happy
       | that it was available to me, and it has likely gotten better.
       | Three, I want that tech to continue to expand and current
       | destruction up there is going to hand this torch to someone else,
       | which makes me sad.
        
         | jjcm wrote:
         | > I was on Microsoft insurance which was quite gold plated at a
         | time
         | 
         | One of the biggest perks of working for Microsoft for a long
         | time was their health coverage. I can't tell you the number of
         | times I'd be doing initial paperwork for a doctor's appointment
         | and the receptionist would be like, "Oh you have THAT
         | insurance, we're going to do all of the tests." I've heard they
         | since cut back on it a little, but it truly was gold plated.
        
           | burnt-resistor wrote:
           | Circa 2005, Stanford FTEs had nine (9) health insurance plan
           | choices. ;P
        
             | dmurray wrote:
             | Is that better or worse than having one really good one?
        
               | burnt-resistor wrote:
               | ;) Paradox of choice potentially, but allowed choosing
               | something other than Kaiser Permanente (HMO with own
               | facilities and doctors) such as a PPO option.
               | 
               | What America really needs is an NHS not tied to
               | employment or exploited by fraudsters delivering worse
               | care for profit. Human rights shouldn't be perks of
               | employment.
        
         | bigtones wrote:
         | My niece in Australia has a rare genetic disorder and when my
         | wife and I had our first baby in California a few years ago we
         | were concerned about that. We also had fantastic insurance and
         | the hospital team there did a test where they took a blood
         | sample from my wife and seperated the childs DNA from the
         | mothers in the blood sample and tested it for several genetic
         | disorders. That test is not available in Australia even today.
        
           | ykl wrote:
           | Incredibly that test (cell-free fetal DNA - cfDNA) is now
           | standard in California, to the point where most expecting
           | parents in California now learn the baby's gender super
           | early. We learned our baby's gender only 10 weeks into
           | pregnancy because of the cfDNA test.
        
           | skissane wrote:
           | > That test is not available in Australia even today.
           | 
           | Pretty much every lab test is available in Australia if you
           | are willing to pay for it; if they don't have a local lab
           | capable of running the test, they'll send the sample overseas
           | 
           | The real question is whether it is covered by insurance or
           | not, and a lot of the time the answer is "no" - I recently
           | forked out over US$500 for genetic tests on one of our kids
           | (which the paediatrician recommended), although the results
           | weren't particularly helpful ("rare variant of uncertain
           | clinical significance")
        
       | tuna-piano wrote:
       | If someone in the year 2050 was to pick out the most important
       | news article from 2025, I won't be surprised if they choose this
       | one.
       | 
       | For those who don't understand this stuff - we are now capable of
       | editing some of a body's DNA in ways that predictably change
       | their attributes. The baby's liver now has different (and better)
       | DNA than the rest of its body.
       | 
       | We still are struggling in most cases with how to deliver the DNA
       | update instructions into the body. But given the pace of change
       | in this space, I expect massive improvements with this update
       | process over time.
       | 
       | Combined with AI to better understand the genome, this is going
       | to be a crazy century.
       | 
       | Further reading on related topics:
       | 
       | https://www.lesswrong.com/posts/JEhW3HDMKzekDShva/significan...
       | 
       | https://www.lesswrong.com/posts/DfrSZaf3JC8vJdbZL/how-to-mak...
       | 
       | https://www.lesswrong.com/posts/yT22RcWrxZcXyGjsA/how-to-hav...
        
         | bglazer wrote:
         | The "How to make superbabies" article demonstrates a couple of
         | fundamental misunderstandings about genetics that make me think
         | the authors don't know what they're talking about at a basic
         | level. Zero mention of linkage disequilibrium. Zero mention of
         | epistasis. Unquestioned assumptions of linear genotype-
         | phenotype relationships for IQ. Seriously, the projections in
         | their graphs into "danger zone" made me laugh out loud. This is
         | elementary stuff that theyre missing but the entire essay is so
         | shot through with hubris that I don't think they're capable of
         | recognizing that.
        
           | cayley_graph wrote:
           | The EA community is generally incapable of self-awareness.
           | The academic-but-totally-misinformed tone is comparable to
           | reading LLM output. I've stopped trying to correct them, it's
           | too much work on my part and not enough on theirs.
        
             | Kuinox wrote:
             | What does EA means here ?
        
               | cayley_graph wrote:
               | "Effective Altruism", something I find myself aligned
               | with but not to the extremes taken by others.
        
               | alexey-salmin wrote:
               | Technically lesswrong is about rationalists not effective
               | altruists, but you're right in a sense that it's the same
               | breed.
               | 
               | They think that the key to scientific thinking is to
               | forego the moral limitations, not to study and learn. As
               | soon as you're free from the shackles of tradition you
               | become 100% rational and therefore 100% correct.
        
               | stogot wrote:
               | Except no one is 100% rational nor 100% correct
        
               | cnity wrote:
               | That community is basically the "r/iamverysmart" types
               | bringing their baggage into adulthood. Almost everything
               | I've read in that sphere is basically Dunning-Kruger to
               | the nth degree.
        
               | jaidhyani wrote:
               | Approximately no one in the community thinks this. If you
               | can go two days in a rationalist space without hearing
               | about "Chesterton's Fence", I'll be impressed. No one
               | thinks they're 100% rational nor that this is a
               | reasonable aspiration. Traditions are generally regarded
               | as sufficiently important that a not small amount of
               | effort has gone into trying to build new ones. Not only
               | is the case that no one thinks that anyone including
               | themselves is 100% correct, but the community norm is to
               | express credence in probabilities and convert those
               | probabilities into bets when possible. People in the
               | rationalist community constantly, loudly, and proudly
               | disagree with each other, to the point that this can make
               | it difficult to coordinate on anything. And everyone is
               | obsessed with studying and learning, and constantly
               | trying to come up with ways to do this more effectively.
               | 
               | Like, I'm sure there are people who approximately match
               | the description you're giving here. But I've spent a lot
               | of time around flesh-and-blood rationalists and EAs, and
               | they violently diverge from the account you give here.
        
               | winterdeaf wrote:
               | So much vitriol. I understand it's cool to hate on EA
               | after the SBF fiasco, but this is just smearing.
               | 
               | The key to scientific thinking is empiricism and
               | rationalism. Some people in EA and lesswrong extend this
               | to moral reasoning, but utilitarianism is not a pillar of
               | these communities.
        
               | xrhobo wrote:
               | Empiricism and rationalism both tempered by a heavy dose
               | of skepticism.
               | 
               | On the other hand, maybe that is some kind of fallacy
               | itself. I almost want to say that "scientific thinking"
               | should be called something else. The main issue being the
               | lack of experiment. Using the word "science" without
               | experiment leads to all sorts of nonsense.
               | 
               | A word that means "scientific thinking is much as
               | possible without experiment" would at least embedded a
               | dose of skepticism in the process.
               | 
               | The Achilles heel of rationalism is the descent into
               | modeling complete nonsense. I should give lesswrong
               | another chance I suppose because that would sum up my
               | experience so far, empirically.
               | 
               | EA to me seems like obvious self serving nonsense. Hiding
               | something in the obvious to avoid detection.
        
               | morsecodist wrote:
               | Effective Altruism is such an interesting title. Almost
               | no one views their Altruism as ineffective. The
               | differentiator is what makes their flavor of Altruism
               | effective, but that's not in the title. It would be like
               | calling the movement "real Altruism" or "good Altruism".
               | 
               | A good name might be rational Altruism because in
               | practice these people are from the rationalist movement
               | and doing Altruism, or what they feel is Altruism. But
               | the "rationalist" title suffers from similar problems.
        
               | kmmlng wrote:
               | I suppose in the beginning, it was about finding ways to
               | measure how effective different altruistic approaches
               | actually are and focusing your efforts on the most
               | effective ones. Effective then essentially means how much
               | impact you are achieving per dollar spent. One of the
               | more convincing ways of doing this is looking at
               | different charitable foundations and determining how much
               | of each dollar you donate to them actually ends up being
               | used to fix some problem and how much ends up being
               | absorbed by the charitable foundation itself (salaries
               | etc.) with nothing to show for it.
               | 
               | They might have lost the plot somewhere along the line,
               | but the effective altruism movement had some good ideas.
        
               | morsecodist wrote:
               | This is a super fair summary and has shifted my thinking
               | on this a bit thanks.
        
               | agos wrote:
               | "Measurable altruism" would have been a better name
        
               | sfink wrote:
               | > One of the more convincing ways of doing this is
               | looking at different charitable foundations and
               | determining how much of each dollar you donate to them
               | actually ends up being used to fix some problem and how
               | much ends up being absorbed by the charitable foundation
               | itself (salaries etc.) with nothing to show for it.
               | 
               | Color me unconvinced. This will work for some situations.
               | At this point, it's well known enough that it's a target
               | that has ceased to be a good measure (Goodhart's Law).
               | 
               | The usual way to look at this is to look at the
               | percentage of donations spent on administrative costs.
               | This makes two large assumptions: (1) administrative
               | costs have zero benefit, and (2) non-administrative costs
               | have 100% benefit. Both are wildly wrong.
               | 
               | A simple counterexample: you're going to solve hunger. So
               | you take donations, skim 0.0000001% off the top for your
               | time because "I'm maximizing benefit, baby!", and use the
               | rest to purchase bananas. You dump those bananas in a
               | pile in the middle of a homeless encampment.
               | 
               | There are so many problems with this, but I'll stick with
               | the simplest: in 2 weeks, you have a pile of rotten
               | bananas and everyone is starving again. It would have
               | been better to store some of the bananas and give them
               | out over time, which requires space and maybe even
               | cooling to hold inventory, which cost money, and that's
               | money that is not directly fixing the problem.
               | 
               | There are so many examples of feel-good world saving that
               | end up destroying communities and cultures, fostering
               | dependence, promoting corruption, propping up the
               | institutions that causing the problem, etc.
               | 
               | Another analogy: you make a billion dollars and put it in
               | a trust for your grandchild to inherit the full sum when
               | they turn 16. Your efficiency measure is at 100%! What
               | could possibly go wrong? Could someone improve the
               | outcome by, you know, administering the trust for you?
               | 
               | Smart administration can (but does not have to) increase
               | effectiveness. Using this magical "how much of each
               | dollar... ends up being used to fix some problem" metric
               | is going to encourage ineffective charities and deceptive
               | accounting.
        
               | concordDance wrote:
               | The vast majority of non-EA charity givers to not expend
               | effort on trying to find the most dollar efficient
               | charities (or indeed pushing for quantification at all),
               | which makes their altruism ineffectual in a world with
               | strong competition between charities (where the winners
               | are inevitably those who spend the most on acquiring
               | donations).
        
               | mushi01 wrote:
               | Do you really think all altruism is effective? Caring
               | about the immediate well-being of others is not as
               | effective as thinking in the long term. The altruism you
               | are describing is misguided altruism, which ultimately
               | hurts more than it helps, while effective altruism goes
               | beyond the surface-level help in ways that don't enable
               | self-destructing behaviours or that don't perpetuate the
               | problem.
        
               | morsecodist wrote:
               | No I think almost all people doing altruism at least
               | _think_ what they are doing is effective. I totally get
               | that they EA people believe they have found the one true
               | way but so does do others. Even if EA is correct it just
               | makes talking about it confusing. Imagine if Darwin has
               | called his theory  "correct biology".
        
               | tim333 wrote:
               | >Almost no one views their Altruism as ineffective
               | 
               | As someone who has occasionally given money to charities
               | for homelessness and the like I don't really expect it to
               | fix much. More the thought that counts.
        
               | zarathustreal wrote:
               | I like to call this "lazy altruism"
        
               | JeremyNT wrote:
               | Note that these people often condescendingly refer to
               | themselves as "rationalists," as if they've unlocked some
               | higher level of intellectual enlightenment which the rest
               | of us are incapable of achieving.
               | 
               | In reality, they're simply lay people who synthesize a
               | lot of garbage they find on the Internet into overly
               | verbose pseudo-intellectual blog posts filled with both
               | the factual inaccuracies of their source material and new
               | factual inaccuracies that they invent from whole cloth.
        
             | static_void wrote:
             | I once went into a LessWrong IRC server.
             | 
             | I posted a question where I referred to something by the
             | wrong name.
             | 
             | Someone said I was confused / wrong, so I corrected myself
             | and restated my question.
             | 
             | For some 10 minutes they just kept dogpiling on the use of
             | the wrong term.
             | 
             | Never a bunch a stupider people have I met than LessWrong
             | people.
        
               | Workaccount2 wrote:
               | Reminds me why I learned long ago to never post your code
               | online when looking for help.
               | 
               | 50 replies arguing about how you can simplify your for()
               | loop syntax and not one reply with an actual answer.
        
             | AlexeyBelov wrote:
             | It's like Mensa: if you really want to be a part of Mensa
             | and _be known for that_ , are you really that smart?
        
           | concordDance wrote:
           | Do you have some further reading where one can understand the
           | basics of the subject?
        
           | tuna-piano wrote:
           | Thanks for the healthy skepticism.
           | 
           | I still think there's a lot to learn from those articles for
           | most folks uninvolved in this area, even if some of their
           | immediate optimism has additional complications.
           | 
           | I think what I mostly took away is a combination of
           | technologies is likely to dramatically change how we have
           | babies in the future.
           | 
           | 1. We'll make sperm/egg from skin cells. This has already
           | been done in mice[1], so it is not science fiction to do it
           | in people.
           | 
           | 2. When we're able to do this inexpensively, we could create
           | virtually unlimited embryos. We can then select the embryos
           | that have the most optimal traits. Initially, this may be
           | simple things like not choosing embryos with certain genes
           | that give higher risk of certain diseases.
           | 
           | This may involve selecting traits like intelligence and
           | height (there are already companies that offer this embryo
           | selection capability [2]).
           | 
           | 3. Instead of creating a lot of embryos and selecting the
           | best ones, we could instead create just one embryo and edit
           | the DNA of that embryo, which has already been done in humans
           | [3]. Alternatively, we could edit the DNA of the sperm/egg
           | prior to creating the embryo.
           | 
           | The fact that none of this is science fiction is just wild.
           | All of these steps have already been done in animals or
           | people. Buckle up, the future is going to be wild.
           | 
           | [1] https://www.npr.org/sections/health-
           | shots/2023/05/27/1177191...
           | 
           | [2] https://www.theguardian.com/science/2024/oct/18/us-
           | startup-c...
           | 
           | [3] https://www.science.org/content/article/chinese-
           | scientist-wh...
        
         | andreygrehov wrote:
         | Are there any age restrictions?
        
         | fendy3002 wrote:
         | the usual next questions will be:
         | 
         | - how further can we push this to make the best, most optimized
         | human?
         | 
         | - what are moral implication of this?
         | 
         | - what are the side effects / downsides?
        
           | Panzer04 wrote:
           | Can it be applied to adults? Useless for this particular
           | disorder, but what about others?
        
           | kjkjadksj wrote:
           | Low hanging fruit is very low hanging in this case. There are
           | many point mutations for example that confer risk to disease
           | and cancer. Lynch syndrome which confers significant risk for
           | colorectal cancer for example is something that could he
           | cured with transgenic humans today even with todays
           | technology. Just a matter of screening gametes for the
           | mutation (usually one base in the case of Lynch in
           | heterozygous state with wild type healthy allele and that
           | wild type healthy allele gets a second hit mutation as the
           | cancer develops and things just go off the rails from there)
           | and editing that base back to wildtype. No downside only
           | upside with that.
           | 
           | What gets harder are polygenic traits that even today we
           | don't have great data on what are the causal alleles. But
           | that is also not a technological limitation either but a
           | statistical one from insufficient sampling of these polygenic
           | phenotypes.
        
           | flakeoil wrote:
           | I also wonder what happens if this kid one day has kids. In
           | this case it was a very rare genetic disease, but if the same
           | was applied to a less rare genetic disease (where it is also
           | more beneficial to have a treatment as more people have use
           | of it) wouldn't the end result be that more and more kids
           | will be born with these diseases?
        
             | eimrine wrote:
             | I hope we can not just heal a disease for one phenotype,
             | but cure it for the whole breed.
        
           | xvilka wrote:
           | There's no "most optimized human". We are already that,
           | perfected in millions of years. What could really happen is
           | the split between multiple sub-species. For example, it makes
           | perfect sense to do the optimization for orbital station
           | dwellers or Mars colonists or underwater dwellers.
        
             | mr_toad wrote:
             | We're not perfect, we're just good enough to have survived.
             | 
             | There are lots of hereditary illnesses and conditions that
             | could probably be tweaked with DNA editing, if we can
             | identify the responsible genes. If someone can cure male
             | pattern baldness they'll be rich.
        
         | rob74 wrote:
         | That's all very cool, but there are also articles like this
         | one: https://www.theguardian.com/us-news/2025/feb/20/trump-nih-
         | cu... - I'm not able to read the Times article because it's
         | paywalled, but as other commenters have mentioned, this
         | research was funded by the NIH, which the Trump administration
         | is currently in the process of defunding. So, if further
         | progress along this road will be made, it'll probably be much
         | slower and less likely to be in the US.
        
           | cnity wrote:
           | Or, it means that funding will be secured in the private
           | sector. Basically by investors that focus on revenue streams
           | (read: extremely expensive private healthcare).
        
             | rob74 wrote:
             | Yeah, maybe for stuff like this which (now) has direct
             | applications, yes. But for basic research (and it took
             | decades of basic research on genetics, gene editing etc.
             | etc. to get to this point)? No way...
        
           | top_sigrid wrote:
           | https://archive.ph/VNYzA
        
         | RandallBrown wrote:
         | Is all the DNA in the liver different, or just a percentage of
         | the cells?
        
         | kjkjadksj wrote:
         | Easiest way to do this stuff is before fertilization when you
         | have one egg and one sperm to work with. Delivering change
         | through a multicellular organism is very challenging. All this
         | stuff like transgenic mice are set up in mutant crosses before
         | this stage, before mating really.
         | 
         | Eventually this will be the outcome of our species to edit the
         | gametes themselves. The issue to overcome for this again won't
         | be technological as that is pretty much solved but getting
         | people over their own "ick" factor.
        
           | something098 wrote:
           | >>>Easiest way to do this stuff is before fertilization when
           | you have one egg and one sperm to work with. Yes. But it
           | seems, that nature so far is still better than we at picking
           | better quality cells in laboratory environment. Not all eggs
           | and sperms are equal - the difference in DNA quality varies.
           | 
           | >>>Eventually this will be the outcome of our species to edit
           | the gametes themselves. The issue to overcome for this again
           | won't be technological as that is pretty much solved but
           | getting people over their own "ick" factor. This is a new
           | fear unlocked, as this will be like another cosmetic surgery
           | procedure, which from my minimal understanding does not
           | affect DNA that is delivered to offsprings - that could be
           | changed but require a lot more work, but like you mentioned -
           | it is easier to do before fertilization :). It is catch22
           | situation rn.
        
           | DoctorOetker wrote:
           | >The issue to overcome for this again won't be technological
           | as that is pretty much solved but getting people over their
           | own "ick" factor.
           | 
           | Probably requires getting investors over their profit
           | incentive first, why treat a heritable disease for the
           | offspring if you can charge them on a per person basis?
        
         | nextaccountic wrote:
         | > For those who don't understand this stuff - we are now
         | capable of editing some of a body's DNA in ways that
         | predictably change their attributes. The baby's liver now has
         | different (and better) DNA than the rest of its body.
         | 
         | How to avoid having only parts of the liver with the new DNA,
         | and some other parts with the old DNA? Like a chimeric liver -
         | isn't this something bad?
        
       | beeflet wrote:
       | the road to hell is paved with good intentions. In our lifetimes
       | we will see a brave new world controlled through eugenics.
        
         | TechDebtDevin wrote:
         | You call it eugenics, I call it biohacking ;)
        
         | Sabinus wrote:
         | Gene editing is not eugenics. Eugenics are managed human
         | breeding programs. Gene editing is gene editing.
         | 
         | In fact, gene editing completely removes the need for eugenics
         | programs.
        
         | SalmoShalazar wrote:
         | The wealthy are already engaged in eugenics via IVF embryo
         | selection. There are several American startups whose clientele
         | are mainly rich SV types that want to optimize the genetics of
         | their children.
        
           | hooverd wrote:
           | I feel bad for those kids. Imagine having an issue that
           | wasn't caught and your parents now see you as defective
           | goods.
        
       | burnt-resistor wrote:
       | Hmm, I thought clinical gene editing (gene therapy) was frowned
       | upon because it's inherently risky and fraught with ethical
       | hazards. What technically and ethically has changed since 2005
       | beyond CRISPR?
        
         | bglazer wrote:
         | Germline gene editing is still considered risky and unethical.
         | That is, editing cells that form eggs and sperm, thus changing
         | the genome of some of the descendants of the edited person.
         | This is somatic editing. These edits will not be inherited.
         | 
         | Somatic editing is becoming more common (see Casgevy) but there
         | are technical hurdles that prevent its application to many
         | cases.
        
           | zharknado wrote:
           | > This is somatic editing. These edits will not be inherited.
           | 
           | Genuine question- how do we know that? Is it just that the
           | edits are very improbable to accumulate in the gonads in
           | sufficient quantities to persist? We can't actually prevent
           | some fraction of them from reaching other parts of the body,
           | right?
        
             | burnt-resistor wrote:
             | I'd like to know that too. When a gene therapy is
             | administered to a person after birth, what % of cells get
             | the edit and with what approach(es)? Doesn't that also edit
             | oocytes and spermatocytes too?
        
       | pawanjswal wrote:
       | Incredible to see science and love come together to rewrite a
       | baby's future.
        
       | karunamurti wrote:
       | I thought the first gene edited babies were from He Jiankui
        
       | lemonberry wrote:
       | I know nothing of this area, but it seems to me this could make
       | cloning easier, right?
        
       | aussieguy1234 wrote:
       | What does this mean for longevity research? Could the same
       | treatment potentially be adapted to make edits that could
       | lengthen lifespan of healthy people?
        
       | adamredwoods wrote:
       | Let's be specific, they don't know if he is fully cured. They
       | need more time to conclude efficacy.
        
         | Cthulhu_ wrote:
         | While true, so far so good - the baby is 9 1/2 months old now,
         | whereas they had a life expectancy of a week earlier without
         | intervention.
        
       | claudeomusic wrote:
       | Damn what a strange time to be alive. Juxtaposing this against
       | the constant nonsense coming from RFK is as jarring as it gets.
        
       | zephyreon wrote:
       | This is incredible. Probably the most exciting piece of news I've
       | read in years.
        
       | kouru225 wrote:
       | Pandora's box just opened
       | 
       | Again
        
       | nothrowaways wrote:
       | We done to Musunuru an amazing cardiologist.
        
       | ddudas wrote:
       | I am sure this article would have been mentioned in _Homo Deus_
        
       | Brystephor wrote:
       | This is incredible work. Its jaw dropping to learn that something
       | like this is possible at all. Sometimes I wish I could work for a
       | company whose products make a meaningful positive contribution to
       | the work.
       | 
       | Do companies like this have a need for SWEs? Are there
       | opportunities for a backend SWE without any background in
       | hardware or biology?
        
         | globular-toast wrote:
         | > Do companies like this have a need for SWEs? Are there
         | opportunities for a backend SWE without any background in
         | hardware or biology?
         | 
         | Of course they do. Biology and medical research can't get
         | enough software people. But they're not as well funded as
         | advertising or spying companies, for example, so you might have
         | to take a significant pay cut.
         | 
         | I wouldn't pigeon hole yourself as a "backend engineer". Why do
         | people do that? Software is software. The bit that matters is
         | the core model and algorithms etc. Whether it's exposed as a
         | web server, a CLI or just a library is a peripheral detail.
         | 
         | It's totally possible for a decent software engineer to learn
         | just enough biology to get by. The limiting factor might be
         | your interest, though. But if you have that then go for it. Get
         | a book on genomics right now.
        
         | rubidium wrote:
         | Yes. Aldevron and IDT are two companies (owned by danaher) that
         | collaborated to make this happen. They have multiple authors
         | listed in the NEJM article.
         | 
         | https://jobs.danaher.com/global/en/search-results?keywords=S...
        
           | waiquoo wrote:
           | Mark Behlke's group at IDT is the force behind a LOT of the
           | development of CRISPR, but they are relatively unknown
        
         | armedgorilla wrote:
         | I run a small software team at a small biotech working on
         | diseases with small patient populations, and the answer is yes
         | x 1000. The issue is that in drug companies, software isn't the
         | product, so SWEs will never make as much money nor be as much
         | of a priority as in tech-proper.
         | 
         | There are two categories of software we need help with:
         | 
         | 1. Salesforce for science. We don't have big data in terms of
         | volume; we have big data in terms of heterogeneity. Tons of
         | small data sets that need context to be interpreted, including
         | measuring uncertainty. This software, often called an eLN or
         | LIMS, is offered by expensive vendors who each have their
         | custom, locked-in implementations. Every organization needs
         | customization on top of this that can be developed and change
         | with the changing direction of the bench scientists.
         | 
         | 2. Informatics tools. Much of the heavier computational tools
         | (bioinformatics, molecular dynamics, stats) were developed by
         | academic labs, who don't have the training or incentives to
         | create sustainable software. Alternatively, they are made by
         | vendors who write software on short-term contracts, so they
         | don't have expertise in house. Our mass spec vendor told us to
         | put their analysis servers on our Citrix so employees could
         | access it. Citrix! If you can convince those vendor to hire you
         | and rewrite their software, please do.
         | 
         | Despite cool tools like alphafold making headlines, the
         | software needs in drug development are more mundane. We need
         | people who are excited to sit down with bench scientists and
         | help them figure out how very normal tools can be applied to
         | their work.
        
       | carabiner wrote:
       | Could this be used to heal adults with the same genetic disorder?
        
       | palisade wrote:
       | Does this mean when they grow up, their own offspring will also
       | have this defect and require a correction? And, if so, does this
       | mean it is now introducing this defective gene into our gene
       | pool?
       | 
       | I know this is an issue with caesarean section. It is becoming
       | more prevalent because those who require it are surviving, making
       | it more likely to happen in their offspring.
        
         | mondaygreens wrote:
         | How can they pass it on when they don't have the defect any
         | more?
        
           | raldi wrote:
           | The DNA was only edited in the liver. But by the time this
           | baby grows up and starts a family, we'll probably be able to
           | fix that, too.
        
             | aucisson_masque wrote:
             | That's a bold claim. The baby is 9 month old, there are
             | many things that can still go wrong with this experimental
             | treatment.
             | 
             | Hopefully not, but even then no one can say what progress
             | will make science in the next 25 years.
             | 
             | Back in the 50's people thought we would be driving in
             | flying car in 2000.
        
               | raldi wrote:
               | Four years ago highly-upvoted /r/SanFrancisco comments
               | said self-driving taxis were decades away: https://old.re
               | ddit.com/r/sanfrancisco/comments/nbjsij/real_r...
        
               | aucisson_masque wrote:
               | 12 upvotes...
               | 
               | You can't compare that to gene-editing treatments, that's
               | two completely different level.
               | 
               | Self driving car were always almost feasible, 20 years
               | ago top gear made cars you could drive with controller
               | like kids do with toy cars. We already had camera and
               | computer, it was just a matter of raw CPU performance and
               | software development..
        
               | bdangubic wrote:
               | we have all the CPU performance we need and all software
               | development we need and self-driving cars are driving
               | around in roughly 0.00785% of world's cities :)
        
           | nahsra wrote:
           | Gene editing is still pretty crude in terms of delivery.
           | 
           | Just because you can hit some germ-line cells in the liver,
           | for example, doesn't imply you'll have good penetration into
           | the reproductive organs.
           | 
           | We can't zap people and change all their DNA at once, unless
           | we can intervene at the point it's just a few cells.
        
           | poilcn wrote:
           | It only affects some cells, not the whole body.
        
           | pishpash wrote:
           | If by "they" you mean their gametes, those were not edited.
           | Only a component of their corporal shell was modified.
        
         | foreigner wrote:
         | We get half of our genes from each of our parents. So unless
         | this person has the extremely unlikely misfortune of partnering
         | with someone else with the same rare mutation, their offspring
         | would only have a 50/50 chance of inheriting their copy of this
         | gene. There are also medical procedures (PGD) to bring that
         | chance to virtually 0%.
        
           | Sammi wrote:
           | Also parents who are both carriers have a 25% chance of
           | making a sick child, a 25% chance of making a non carrier and
           | non sick child, and a 25%+25% chance of making non sick yet
           | carrier child. So they already have a 50% chance of making
           | children who'll survive and yet be carriers of the disease. I
           | guess this will increase this to 75%. But you have to
           | evaluate this in connection with the rapid increases in
           | genetic treatment options, which decreases the issues.
        
           | something098 wrote:
           | We don't get 50/50 of distinct genes from our parents - it is
           | more like 30/70 and can be even 10/90. The whole DNA ratio in
           | this equation is irrelevant, as we all have 99% of the same
           | DNA. Also, in real world, one parent will consistently give
           | more of their distinct genes than other parent and most
           | likely that consistent gene part will have that single
           | mutation that they would hope to avoid, but contain best
           | genes that the parent can offer. Children from multiple
           | partners could be a solution as it is a different math...
           | 
           | >>>There are also medical procedures (PGD) to bring that
           | chance to virtually 0%. For that one gene only. DNA is a math
           | of sum of genes and from what I have read humans are not
           | better than nature(which is not perfect, but very basic) at
           | selecting best specimens of eggs and sperm, but yes -
           | whatever they have picked - PGD might be able to root out
           | that one single mutation, and introduce variety of other
           | mutations or miss good genes from other combinations. So, it
           | all depends...
        
         | rkangel wrote:
         | > know this is an issue with caesarean section. It is becoming
         | more prevalent because those who require it are surviving
         | 
         | You state this as a fact and I've heard it as a strong
         | hypothesis, but I wasn't aware of much evidence to confirm it?
        
           | palisade wrote:
           | "The cesarean delivery rate increased from 5% in 1970 to
           | 31.9% in 2016. This sharp increase can be attributed to
           | various factors, including changes in maternal age, medical
           | advancements allowing more complicated pregnancies to
           | proceed, and evolving obstetric practices. In 2022, the
           | United States recorded more than 3.66 million births, most of
           | which resulted from spontaneous or induced labor. Labor
           | dystocia remains the most common indication for primary
           | cesarean delivery. Globally, cesarean delivery rates continue
           | to rise, and reducing unnecessary cesarean procedures remains
           | a priority in the United States, where 32.2% of all births in
           | 2022 were cesarean deliveries."
           | 
           | https://www.ncbi.nlm.nih.gov/books/NBK546707/
           | 
           | "If this trend continues, by 2030 the highest rates are
           | likely to be in Eastern Asia (63%), Latin America and the
           | Caribbean (54%), Western Asia (50%), Northern Africa (48%)
           | Southern Europe (47%) and Australia and New Zealand (45%),
           | the research suggests."
           | 
           | https://www.who.int/news/item/16-06-2021-caesarean-
           | section-r...
           | 
           | Note: Coincidentally, WHO's article I've linked is lamenting
           | that Sub-saharan Africa only had 5% cesarean due to less
           | availability of the procedure. It is their perspective that
           | the increase in percentages is a good thing and indicates
           | progress, instead of being concerning. And, they find Sub-
           | saharan Africa's low numbers concerning, instead.
           | 
           | Side Note: I also found lots of interesting articles which I
           | haven't posted here, about epigenetic side effects caused by
           | caesarean deliveries like leukemia, illnesses and other
           | genetic issues. But, that seems out of scope for your
           | question. You can make a quick search and find these, though.
           | 
           | "A female-to-female familial predisposition to caesarean
           | section was observed. It could be caused by biologic
           | inheritance, primarily working through maternal alleles
           | and/or environmental factors. The results imply that both
           | mechanisms could be important."
           | 
           | https://pubmed.ncbi.nlm.nih.gov/18540028/
           | 
           | "Large-scale epidemiological studies indeed evidence that
           | women born by C-section are more likely to deliver by
           | Caesarean than women born vaginally, owing primarily to
           | genetic rather than social factors."
           | 
           | https://www.pnas.org/doi/10.1073/pnas.1712203114
        
             | rkangel wrote:
             | Interesting - thank you!
        
             | squigz wrote:
             | > Another Note: Also, ironically WHO's article I've linked
             | is lamenting that Sub-saharan Africa only had 5% cesarean
             | due to less availability of the procedure. It is their
             | perspective that the increase in percentages is a good
             | thing and indicates progress, instead of being concerning.
             | And, they find Sub-saharan Africa's low numbers concerning,
             | instead.
             | 
             | Pretty sure their perspective is that "saving the lives of
             | mothers and babies" indicates progress.
             | 
             | > While a caesarean section can be an essential and
             | lifesaving surgery, it can put women and babies at
             | unnecessary risk of short- and long-term health problems if
             | performed when there is not medical need.
             | 
             | > Rather than recommending specific target rates, WHO
             | underscores the importance of focusing on each woman's
             | unique needs in pregnancy and childbirth.
             | 
             | > WHO recommends some non-clinical actions that can reduce
             | medically unnecessary use of caesarean sections, within the
             | overall context of high quality and respectful care:
        
               | palisade wrote:
               | Yes, that's what they're indicating. And, it is saving
               | lives. I myself was cesarean section, as was my mother. I
               | wouldn't be here without it.
               | 
               | That's the potential conundrum, if it turns out to be
               | vastly increasing the need to save those lives than in
               | the past due to a evolutionary pressure on the gene pool.
               | If the WHO is right and we're going to start seeing 50 -
               | 63% increases by 2030, what's in store for the human race
               | if this rate of expansion keeps up?
               | 
               | Will we reach a time when no one can be naturally born
               | and almost our entire race has to be conceived in
               | external gestation devices or cease to exist? And, when
               | we reach that point will we look with concern towards
               | Africa and wonder at how sad it is they're still
               | conceived naturally.
               | 
               | Edit: I don't have the answers. I'm not sure what we
               | should do to course correct or if we need to. But, it is
               | definitely something that should be looked into before it
               | is too late, if it isn't already. And, that is why I
               | brought it up in the context of this breakthrough, to ask
               | if we've considered similar consequences. And, if we have
               | a way to mitigate them if that turns out to be the case.
        
               | squigz wrote:
               | Are c-sections replacing 'natural' births, or are they
               | simply becoming more common because we have the
               | expertise? There is a difference
        
               | palisade wrote:
               | The research I've cited has indicated this is a genetic
               | transfer among female-to-female births of a need for more
               | cesareans.
               | 
               | "A female-to-female familial predisposition to caesarean
               | section was observed. It could be caused by biologic
               | inheritance, primarily working through maternal alleles
               | and/or environmental factors. The results imply that both
               | mechanisms could be important."
               | 
               | https://pubmed.ncbi.nlm.nih.gov/18540028/
               | 
               | "Large-scale epidemiological studies indeed evidence that
               | women born by C-section are more likely to deliver by
               | Caesarean than women born vaginally, owing primarily to
               | genetic rather than social factors."
               | 
               | https://www.pnas.org/doi/10.1073/pnas.1712203114
        
               | squigz wrote:
               | > "Large-scale epidemiological studies indeed evidence
               | that women born by C-section are more likely to deliver
               | by Caesarean than women born vaginally, owing primarily
               | to genetic rather than social factors."
               | 
               | Interesting. That makes sense. I wonder if the type of
               | research being pursued in TFA might be helpful.
               | 
               | In any case, I also have to wonder whether it's
               | necessarily a bad thing. I quoted 'natural' births
               | earlier because... what is natural? The amount of medical
               | knowledge and technology that go into births doesn't seem
               | very "natural" to me, and this has advanced through the
               | ages to where we are now - where we, rightfully so, look
               | sadly on areas where lack of such technology and
               | knowledge result in more preventable deaths of babies,
               | even if their methods are more "natural"
               | 
               | Of course, to be honest, I'm not very familiar with the
               | pros and cons of c-sections vs natural births -
               | particularly when the question is whether to have a
               | child. I suppose that, given the choice between a
               | c-section and the alternatives, most women will opt for a
               | c-section, and as you point out, that means their
               | daughters likely will have to as well
               | 
               | So what might the solution even look like, apart from
               | exploring the aforementioned gene-editing technology - or
               | other technology - to prevent the genetic factor of
               | c-sections? I would hope that "don't offer c-sections" is
               | not a serious option. "Stop having kids" is one I'd
               | personally suggest, but that's obviously not a sane
               | global solution either.
               | 
               | It's an interesting problem I'd be curious to hear more
               | about - as I said, I'm not very familiar with this.
        
               | squigz wrote:
               | > Edit Edit: I can't reply to your comment below I think
               | we've hit the leaf end of this post. But, to reply to
               | your question are c-sections replacing natural births or
               | are they just becoming more common? The research I've
               | cited has indicated this is a genetic transfer among
               | female-to-female births of a need for more cesareans.
               | 
               | To reply after a certain number of child comments, you
               | have to open the comment by clicking the timestamp thing
               | 
               | I'm also afraid I don't understand your response. Can you
               | elaborate?
        
               | palisade wrote:
               | Thanks, I replied to your other comment.
        
         | make3 wrote:
         | they could CRISPR his relevant reproductive cells, this general
         | topic is an important subject of discussion
        
           | something098 wrote:
           | Ah, yes - few million of them. Simple task for sure, if the
           | liver is functioning as testes.
        
             | jodrellblank wrote:
             | https://news.ycombinator.com/item?id=34925145
        
               | something098 wrote:
               | This is something I have never seen for decades - a troll
               | that posts links to his own quotes...
               | 
               | We met again.
        
         | Tade0 wrote:
         | Research is inconclusive regarding what exactly causes this
         | increase.
         | 
         | We know that infants are generally larger than 50 years ago and
         | one of the factors which trigger birth is the inability of the
         | mother's metabolism to support further growth of the fetus.
         | 
         | That, combined with the fact that all over the world
         | availability of nutrition is much better than half a century
         | ago points to this being the culprit.
        
       | kjkjadksj wrote:
       | Honestly the biggest barriers to a lot of advancement right now
       | in biology from medicine to our food supply depend squarely on
       | getting uneducated people over their aversions to modern science.
       | It is crazy. We are really at the "I don't trust that
       | locomotive/airplane/car" stage where what the public understands
       | about the field is so far away from the state of the art and the
       | risk considerations that have been put in place by the actual
       | domain experts who have thought of all your concerns already. It
       | isn't just lay people either but government officials in charge
       | or permitting and approvals that need the most convincing. They
       | might be out of the field themselves for a decade or more.
        
         | WorldPeas wrote:
         | The problem is there is so little optimistic futurist media,
         | the number of optimistic movies I've seen about the future I
         | can count on my left hand. I can't square the blame entirely on
         | Hollywood, but it's a shame there is so little discussed about
         | the American state-of-the-art, something I believe China does
         | better is center technological development in discourse, I see
         | very little talk of the modern miracles we've witnessed outside
         | of HN
        
       | stogot wrote:
       | I can't read the full article, but I'm wondering how they got FDA
       | approval for a one-off personalized treatment here outside a
       | trial?
       | 
       | Aren't people dying because they were waiting for FDA approval
       | for other experimental treatments?
        
       | sirobg wrote:
       | Did AI help at any step in the process?
        
       | codeulike wrote:
       | Here's the actual paper
       | 
       | https://www.nejm.org/doi/full/10.1056/NEJMoa2504747
       | 
       | This site has a much better write up than the NYT:
       | 
       | https://innovativegenomics.org/news/first-patient-treated-wi...
       | 
       |  _Under normal circumstances, developing and testing a new CRISPR
       | therapy takes years, but this patient -- and others born every
       | day with severe genetic disorders -- do not have years to wait.
       | Getting all of the pieces together for this emergency need took
       | rapid coordination amongst teams at multiple academic and for-
       | profit organizations, only possible because of both years of
       | preparation and some lucky connections._
       | 
       | ...
       | 
       |  _Prior to receiving the CRISPR therapy, KJ's prognosis was poor,
       | but there were several factors that made KJ's case a good
       | candidate for a rapid CRISPR intervention. An ongoing research
       | study at the IGI called INGENUITI enabled the team to immediately
       | enroll KJ and his parents for genome sequencing and analysis. The
       | mutation in KJ's genome was a single base -- just a one-letter
       | change in his genetic code -- and one that could be corrected
       | using base editing, a gene-editing technique that only makes a
       | single-letter edit. Additionally, the researchers needed to edit
       | cells in the liver, where the faulty protein is made. The liver
       | is currently one of the organs in the body that can be targeted
       | for in vivo gene-editing therapies using lipid nanoparticles._
       | 
       | ...
       | 
       |  _One of the first steps involved characterizing the mutation in
       | KJ's genome and designing the guide RNAs that allow the base
       | editor to precisely target a specific letter in the patient's
       | genome for repair. Kiran Musunuru's team at Penn accomplished
       | that in record time. Next, the team at the IGI jumped in to do
       | the necessary safety assessment work so that the FDA could assess
       | the risks._
        
       | deadbabe wrote:
       | Do you think someday soon we will have the equivalent of an LLM
       | coding assistant, but for gene editing?
        
         | Cthulhu_ wrote:
         | Definitely not soon, there's a lot of conditions at the moment
         | for this to be applicable (from what I gather, I'm no expert,
         | just a HN commenter), and well before wholesale gene editing is
         | a thing there will be the legal aspect.
         | 
         | I mean the precursor to gene editing is selective breeding,
         | which on humans quickly leads to eugenics.
        
           | deadbabe wrote:
           | Don't know why so much fear over eugenics. You either resign
           | to waiting millions of years for evolution to do its thing,
           | or we just take matters into our own hands at some point and
           | evolve faster.
        
         | xrhobo wrote:
         | I love LLMs but that sounds like one of the worst ideas I can
         | even think of.
        
       | sas224dbm wrote:
       | A Gattaca moment ?
        
       | poopsmithe wrote:
       | Thank you scientists! Next, pretty please figure out how to grow
       | ironmouse a new immune system! <3
        
       | otikik wrote:
       | That is great news and my congratulations to the parents.
       | Hopefully it's something that we can repeat many times in the
       | future.
        
       | voidUpdate wrote:
       | Could this be used to actually change the DNA of transgender
       | people?
        
         | albrewer wrote:
         | Even if it did, wouldn't the development of the wrong genitials
         | for their preferred sex make an edit like this meaningless? The
         | existence of XX AMAB and XY AFAB people goes to show that it's
         | more about what happens in utero than what genes you have after
         | birth.
        
         | idontwantthis wrote:
         | That's an entire chromosome throughout every cell in the body.
         | This is a single gene change in one type of cell.
         | 
         | No.
        
       | zoklet-enjoyer wrote:
       | My girlfriend and a couple friends work at one of the companies
       | that developed this and they're quite excited and proud of it and
       | I of them.
        
       | ckemere wrote:
       | The work outlined in the actual paper is quite remarkable. Within
       | this 6 month period they generated transgenic mice with the
       | precise mutations (paternal and maternal) this baby had in order
       | to test treatment for functionality and toxicity as well as a
       | doing a toxicity study in monkeys.
       | 
       | To those thinking about commercialization opportunities, these
       | two steps seem the most labor intensive and time consuming, but
       | also the most necessary in order to actually have confidence to
       | inject completely customized gene editing therapy in a kid.
       | 
       | (Also worth highlighting for folks opposed to animal research.)
        
       | jacktheturtle wrote:
       | we progress closer and closer to a "red rising" type future --
       | exciting and scary. exciting for the family and child <3
        
       | thesparks wrote:
       | My daughter has a genetic condition (PKU) that is also caused by
       | a single letter change in her DNA and also causes brain damage if
       | she consumes too much protein. Luckily it can be controlled with
       | a strict low-protein diet (<10 grams a day).
       | 
       | This is SO exciting! The fact that there is a chance of a cure
       | has absolutely made my day!
        
       | Lichtso wrote:
       | Not to downplay what a huge achievement this is and how far the
       | field of medicine has come, but ...
       | 
       | this still leaves a slight bitter taste in my mouth: If they edit
       | specific genes one way they can also do the opposite direction.
       | And if I understand correctly, they did with a bunch of lab rats?
       | 
       | Now, this and similar stuff have obviously been discussed before,
       | essentially "12 Monkeys": Somebody releasing some runaway gene-
       | editing mechanism, be it a virus or what not, and using it as
       | means to mass destruction. However, that is not even what I worry
       | about because that is nothing new, viruses have existed longer
       | than most other kinds of life on this planet.
       | 
       | Instead, what just popped into my mind is more like ransomware
       | but on your body cells. Attacker edits victims genes to some
       | condition that is lethal within a week or so and then blackmails
       | them in order to edit it back. Kinda like the "Carrying the
       | Antidote"-trope, only that there is no other cure in time.
       | 
       | Maybe worth a Black Mirror episode ... anyway you heard / read it
       | here first ;)
       | 
       | edit: To the people downvoting, why not engage in the
       | conversation instead? I am not saying we shouldn't be doing this,
       | just that this is a fun crime scenario in a movie. What is wrong
       | with that?
        
         | skeaker wrote:
         | If you wanted to do that you could just release a cancer-
         | causing agent and it would similar mess with their DNA and kill
         | them much more effectively at a fraction of the cost. Or just
         | blow them up or something. Harming the masses in such a
         | roundabout way won't leave the realm of science fiction because
         | it is so much less effective and so much more difficult to do
         | than existing methods. Not worth worrying about even in theory.
        
       | treszkai wrote:
       | I love how the last lines of the article read,
       | 
       | > "I don't think this could have happened in any country other
       | than the U.S.," Dr. Urnov said. > "We all said to each other,
       | 'This is the most significant thing we have ever done.'"
       | 
       | And then in the Discover More section is this article:
       | 
       | > Lab Animals Face Being Euthanized as Trump Cuts Research
        
       | opyate wrote:
       | I prefer the Perplexity summary over the nytimes' style of
       | weaving facts with narrative:
       | 
       | https://www.perplexity.ai/page/baby-born-with-life-threateni...
        
       ___________________________________________________________________
       (page generated 2025-05-17 23:01 UTC)