[HN Gopher] Baby is healed with first personalized gene-editing ...
___________________________________________________________________
Baby is healed with first personalized gene-editing treatment
Author : jbredeche
Score : 1199 points
Date : 2025-05-15 18:06 UTC (2 days ago)
(HTM) web link (www.nytimes.com)
(TXT) w3m dump (www.nytimes.com)
| jakubmazanec wrote:
| https://archive.ph/VNYzA
| chewbacha wrote:
| Good thing RFK pushed out the official overseeing this financing
| and the current administration is actively defunding the
| organizations that produced this.
|
| Better to have more disabled or dead babies instead of science.
|
| /s
| JumpCrisscross wrote:
| Genuine question: is this research not being pursued in China?
| sigzero wrote:
| Yes, other countries are pursuing this.
| mylons wrote:
| it is.
| kccqzy wrote:
| A Chinese scientist claimed that he did CRISPR on twins back
| in 2018. https://www.science.org/content/article/crispr-
| bombshell-chi...
|
| He was jailed for illegal medical practices but it seemed
| like he established a proper lab after serving the sentence
| and hopefully he is focused on less objectionable practices.
| https://www.npr.org/2023/06/08/1178695152/china-scientist-
| he...
| pacoWebConsult wrote:
| From a purely utilitarian perspective, funding research like
| this is not an effective use of dollars at the margin. How many
| people could we save if an equivalent amount was put into
| reducing obesity, smoking, and drinking? How many people could
| we save if we stopped spending money we don't have to do things
| that the government isn't competent at allocating anyways?
|
| That's not to say the research itself is not impressive nor
| important, but think critically about the fact that this money
| doesn't exist in a vacuum.
| rco8786 wrote:
| Given the admin's propensity for cutting spending on research
| like this and other domestic interests while ratcheting up
| military spending I think that poster's point stands.
| casey2 wrote:
| Somewhere between 0 and -100,000,000
| tchalla wrote:
| I'm glad we don't only think from a utilitarian perspective
| then.
| psychoslave wrote:
| It's not even that. Utilitarian premises still let a very
| broad set of perspective. A long term perspective on large
| humanity won't lead to same conclusion as what will be the
| most joy inducing experiences in the next 24h for the 1%
| wealthiest people in the world right now.
| benlivengood wrote:
| All those wasted dollars and time put into the discovery of
| the germ theory of disease instead of growing and
| distributing food to the invalids.
| wat10000 wrote:
| How do you know it's not effective? The cost per life saved
| is extremely high _now_ , but this stuff gets better over
| time. How much did penicillin cost to produce originally?
| inglor_cz wrote:
| Early penicilin was rare enough that they collected the
| urine of the first patients and re-extracted penicilin from
| it for further use.
| lukevp wrote:
| Isn't penicillin just bread mold? So probably not a great
| example.
| wat10000 wrote:
| And yet, the first patient treated with mass-produced
| penicillin used half the total supply, and the stuff was
| so rare that it was extracted from patients' urine for
| reuse.
| nonameiguess wrote:
| > How many people could we save if an equivalent amount was
| put into reducing obesity, smoking, and drinking?
|
| How confident are you the answer isn't very close to zero?
| We've already curtailed smoking quite a bit in the past 30
| years. At the level of an individual, it isn't any particular
| mystery how to stop obesity or to simply not drink, but
| population-level interventions attempting to get people to
| voluntarily behave differently for their own health
| historically haven't worked well in these specific domains.
| Throwing more money at the problem doesn't seem like it would
| obviously change that.
|
| Also keep in mind that overeating and alcohol addiction have
| significant genetic components. Research into gene editing
| has the eventual potential to cure damn near _any_ disease,
| including whatever pet causes you personally think are worth
| defeating.
| sigzero wrote:
| It is also capable of creating new diseases that will be
| resistant to anything we currently have to fight with.
| inglor_cz wrote:
| You can torture and execute people with electricity, but
| it does not follow that discovery and use of electricity
| was, on the net, a wash.
| psychoslave wrote:
| >population-level interventions attempting to get people to
| voluntarily behave differently for their own health
| historically haven't worked well in these specific domains
|
| Said like that it paints things like there are not far more
| resources spent on propagating the bad habits (as some ROI
| is expected from this by some actors), and any attempt to
| put a social health program in history always ended in
| major catastrophes.
| vjvjvjvjghv wrote:
| With that line of thinking you would never do any advanced
| science.
| inglor_cz wrote:
| This argument could be used to stop absolutely any research
| that isn't dirt cheap.
|
| Maybe even the dirt cheap one, because even 100 dollars could
| go longer way somewhere in the Sahel.
|
| It is good that the humanity does _not_ have a one-track
| mind.
| jonhohle wrote:
| I've thought about this recently as well and I don't know
| if I have a fully developed view. What is the moral
| responsibility of all people to pay for medical research or
| operations that would affect a small number of people. Is
| it ethical to compel others to pay for the research deemed
| valuable by some, but not by others. Who is the arbiter of
| that research's value?
|
| I could say I believe the government should fund research
| into fixing people who think cilantro tastes like soap
| because for most of us it is delicious and promotes healthy
| diets. Should I be able to compel (tax) you to pay for that
| research?
|
| Where that line is drawn will always be wrong to someone.
| How research is prioritized will always be wrong to
| someone. Is there an ethical way to determine the best use
| of collective resources and what portion of one's property
| must be taken from them to fund that research.
| inglor_cz wrote:
| I think that taxpayers should be advised that science is
| not a straightforward process like building a house from
| blueprints, and that a lot of important discoveries
| happen serendipitously.
|
| The cilantro taste stuff does not sound absurd to me at
| all. In biology, there is no hard wall between banal
| stuff and critical stuff; they interact and fundamentally
| operate in the same environment under the same genetic
| and epigenetic rules. Sure, the research necessary for
| correcting cilantro-as-soap may be marginal, but there is
| a chance of discovering something significant along the
| way.
|
| We should be more careful and also honest when
| communicating about science to taxpayers.
| jonplackett wrote:
| I admit to having a similar thought to this - especially if
| it is then going to be commercialised and sold for millions
| of dollars per treatment.
|
| BUT the long term view of creating a technology that can
| treat any genetic illness (or maybe even any illness?) must
| outweigh that _eventually_
| rcpt wrote:
| A huge amount of money went into researching anti obesity
| medications
| XorNot wrote:
| Which it's worth noting, succeeded so wildly that 1/5th of
| Denmark's jobs growth last year was related to Ozempic
| production.
| os2warpman wrote:
| I think you may be operating under the assumption that the
| extremely expensive price tag will need to be repeated for
| each patient.
|
| In reality, as this process becomes more mature it is going
| to become inexpensive.
|
| The reduction in cost will almost certainly be similar to
| reduction in cost needed to sequence an individual's genome,
| which has fallen from tens of millions to hundreds of
| dollars.
|
| The only catch is that we have to spend money to get there.
|
| Another catch is that the nations who underwrite this
| research will turn millions in investments into trillions in
| dividends and the stingy or poor will be left in the cold.
|
| Seeing that private enterprise is only good at taking
| publicly-funded work and patenting it, and that in the
| absence of public funding nothing ever gets invented, we
| should be all-in on this.
|
| edit: it's apropos that you mentioned obesity because GLP-1
| drugs are the direct, irrefutable, product of spending at
| government labs.
|
| edit2: specifically, a single government scientist playing
| around with lizard saliva in the 1970s because he thought it
| was interesting.
| WorkerBee28474 wrote:
| > In reality, as this process becomes more mature it is
| going to become inexpensive.
|
| There's no evidence to support that gene therapy will ever
| be inexpensive. We can merely say that the process may
| become less shockingly expensive.
| paulryanrogers wrote:
| What should we as humanity, as society, spend most of our
| wealth and resources doing?
|
| Sending robber barrons and their girlfriends into space?
| philipkglass wrote:
| I'm of accord with the Utopians of Ada Palmer's _Too Like
| the Lightning_ :
|
| _When a Utopian dies, of anything, the cause is marked
| and not forgotten until solved. A fall? They rebuild the
| site to make it safe. A criminal? They do not rest until
| he is rendered harmless. An illness? It is researched
| until cured, regardless of the time, the cost, over
| generations if need be. A car crash? They create their
| separate system, slower, less efficient, costing hours,
| but which has never cost a single life. Even for suicide
| they track the cause, and so, patiently, blade by blade,
| disarm Death. Death, of course, has many weapons, and, if
| they have deprived him of a hundred million, he still has
| enough at hand to keep them mortal. For now._
| paulryanrogers wrote:
| So we should not even try to help the sick because
| 'death' has too many other ways to kill them?
| philipkglass wrote:
| I mean the opposite. We should continue seeking cures to
| every fatal condition, from the common to the rare.
| paulryanrogers wrote:
| Thanks for clarifying. Apparently returning to Reddit has
| made me cynical.
| os2warpman wrote:
| >There's no evidence to support that gene therapy will
| ever be inexpensive.
|
| My prediction is based on the number of efforts, too
| numerous to list here, being undertaken to develop lab
| equipment to automate the extremely labor-intensive
| workflow and the accumulation of vast libraries of
| CRISPR-Cas9 screens and dependency maps, the creation of
| which are also expensive and labor-intensive.
| primax wrote:
| > There's no evidence to support that gene therapy will
| ever be inexpensive. We can merely say that the process
| may become less shockingly expensive.
|
| A similar thing has been said about so many cutting edge
| therapies and technologies in the past that I think
| you'll end up being quite surprised.
|
| Eventually someone will invent a machine that spits these
| therapies out like espresso machines.
| SquirrelOnFire wrote:
| 30 million people in the US are affected by "rare" genetic
| conditions.
| dekhn wrote:
| Yes, but the cures here aren't general. They're highly
| specific, and the rare conditions have a long tail- large
| numbers of different conditions, each with a very small
| population of affected individuals, and likely, the
| treatments will be somewhat customized for each type of
| disease.
| pfisherman wrote:
| See my comment above. Getting approval for rare diseases
| and expanding the indication to the common form of the
| disease is a well established strategy in pharma.
| dekhn wrote:
| yes, but that's totally different from coming up with a
| generalized treatment for a wide range of "rare"
| diseases.
| pfisherman wrote:
| Also rare genetic diseases give insight into the underlying
| mechanisms and pathology of common sporadic diseases, which
| can be leveraged to develop new and better therapies.
|
| Getting a new drug or therapy approved for a rare form of a
| disease and then expanding the indication to the common
| disease patient population is a well established strategy.
| delfinom wrote:
| Because reducing obesity, smoking and drinking is not a money
| problem in the slightest.
| DoesntMatter22 wrote:
| I completely disagree, the things you mentioned are all
| things which a person has a level of control over.
|
| This is something beyond that, and is very valuable as this
| baby has no actual means of fighting this issue at all.
|
| And who's to say this won't lead to fixing the other things
| anyway.
|
| Great use of dollars
| xiphias2 wrote:
| It's super effective funding.
|
| There are known DNA changes that would probably help all
| people with chronic diseases, but it's ethically more
| accepted to go for the more fatal diseases and cleaner cases
| first, like a rare mutation with a high fix rate.
| psychoslave wrote:
| That is not comparable at all. To save people from obesity,
| smoking and drinking, you don't need more resources on
| fundamental research. You need different education, and
| socio-economical programs, possibly even less funds on the
| overall: if no resources is spent anymore in promoting bad
| habits, you end up with more financial resources and a
| healthier population.
|
| Instead if no resources is allocated on developing all the
| technical requirements to do such a thing, humanity ends up
| with less tools to heal itself, and that's it.
| caycep wrote:
| a) that statement above has nothing to do with RFK
|
| b) the whole point of NIH and other government research funds
| is to pay for this sort of "not clearly an effective use of
| dollars" type of research that Pfizer et al won't touch. but
| you can look at a ton of future applications from this -
| lipid packaging, CRISPR methods, drug delivery, etc that had
| to be devised, and could conceivably be commercially viable
| if the methodology is perfected and the cost comes down.
| dylan604 wrote:
| The current administration doesn't care about kids. They only
| want you to not terminate a new kid from being born. That they
| care lots about. What happens after birth is not their concern.
| Also, I think when they say they want more babies, they want a
| specific subset of babies to increase.
| philipallstar wrote:
| > The current administration doesn't care about kids.
|
| Of course they do. But untold amounts spent on very few kids
| could be spent elsewhere on many more. Federal budgets are a
| zero-sum game.
|
| > Also, I think when they say they want more babies, they
| want a specific subset of babies to increase.
|
| I've seen quite a few conservative commentators celebrate
| that the massively disproportionate levels of African-
| American abortion have been reduced, resulting in more
| African-American people being born, and zero bemoaning it. So
| maybe you're right.
| colechristensen wrote:
| >KJ has made medical history. The baby, now 9 1/2 months old,
| became the first patient of any age to have a custom gene-editing
| treatment, according to his doctors.
|
| This is _not_ the first human to be treated with a treatment
| under the wide umbrella of gene therapy based on their own edited
| genes. There probably _is_ a more narrow first here but the
| technical details get lost in journalism which is a shame.
| jfarlow wrote:
| "Custom" in that this therapy was designed AFTER a specific
| patient showed a need, and then given to _that_ patient. In
| most every other context a particular class of disease is
| known, a drug designed, and then patients sought that have that
| disease that matches the purpose of the drug.
|
| What's intriguing is not the 'custom' part, but the speed part
| (which permits it to be custom). Part of what makes CRISPR so
| powerful is that it can easily be 'adjusted' to work on
| different sequences based on a quick (DNA) string change - a
| day or two. Prior custom protein engineering would take minimum
| of months at full speed to 'adjust'.
|
| That ease of manipulating DNA strings to enable rapid
| turnaround is similar to the difference between old-school
| protein based vaccines and the mRNA based vaccines. When you're
| manipulating 'source code' nucleic acid sequences you can move
| very quickly compared to manipulating the 'compiled' protein.
| autoexec wrote:
| Okay, I'll bite: Who then was the first patient of any age to
| have a custom gene-editing treatment?
| namuol wrote:
| I know of at least one YouTuber who took a homemade treatment
| that alerted his GI system DNA to produce lactase so he could
| eat pizza again:
|
| https://youtu.be/J3FcbFqSoQY
| codeulike wrote:
| That's not gene editing, but you could call it a gene
| therapy - he's introducing new fragments of DNA/RNA into
| his cells which then just float around and cause the right
| enzyme get made. Sometimes called upregulation. This is
| different to actually editing the existing DNA in the cell.
| namuol wrote:
| Good point - to be honest I didn't realize the difference
| which is very significant from a treatment perspective.
| agos wrote:
| I remember six kids treated with a HIV retrovirus based
| therapy in 2013 in Italy
| caycep wrote:
| I want to say, maybe it's better to say first human under
| proper IRB/regulatory compliance. Some rogue academic in China
| tried it a few years ago, if I recall, but with absolutely no
| oversight and he was pilloried. Also I don't think there is
| much details about what he actually did...
|
| https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
| dekhn wrote:
| What the Chinese guy (He) did was completely different. He
| permanently altered the germline in embryos, which means that
| every cell in the resulting baby is transformed permanently
| with the change he made. The work he did violated a wide
| range of good practice (specifically, the change he made
| didn't actually work for the goal he desired, and he also
| ignored all the ethical advice around this experiment, and
| avoided getting the necessary approvals).
|
| This research is instead a therapy used to treat an already
| born baby, and it doesn't modify all the cells in the body.
| Many cells in the body that are transformed by this technique
| will eventually die and be replaced by clones of stem cells
| which weren't transformed. I haven't read in detail about
| whether this therapy targets stem cells, and how long term
| effective the treatment will be- hepatocytes (liver cells)
| turn over constantly, so I would expect if the treatment did
| not affect the hepatocyte stem cells, it would only last
| ~months and the treatment would have to be repeated.
| SubiculumCode wrote:
| Do new liver cells always come from stem cells, not from
| dividing liver cells? Are those heppatocyte stem cells
| reside in the liver, or do they travel their via
| migration,.or blood, etc?
|
| A quick search suggests that liver regen involves dividing
| mature liver cells to replace turnover. If so, I'd suspect
| that they'd continue to carry the.crispr edit forward.
| zardo wrote:
| The major difference is that was a hereditary change. So
| those changes could now diffuse throughout the species over
| time. As I recall it was a change that reduces vulnerability
| to HIV infection.
| MrZander wrote:
| > To accomplish that feat, the treatment is wrapped in fatty
| lipid molecules to protect it from degradation in the blood on
| its way to the liver, where the edit will be made. Inside the
| lipids are instructions that command the cells to produce an
| enzyme that edits the gene. They also carry a molecular GPS --
| CRISPR -- which was altered to crawl along a person's DNA until
| it finds the exact DNA letter that needs to be changed.
|
| That is one of the most incredible things I have ever read.
| poyu wrote:
| Made it sound like it's a computer, is it Turing complete?
| lordnacho wrote:
| Wouldn't it be surprising if it weren't? There's a bunch of
| things that are Turing complete, but they are not literally a
| molecular tape with machinery to read and write it.
| caycep wrote:
| I think I recall reading at least some papers or at least
| exercises trying to draw analogies between Turing machines
| and ribosome/proteonsome and other type of cellular proteins,
| but I can't remember back to that class some 20 years ago...
| fwip wrote:
| Not really. Delivering gene edits via CRISPR in this way is
| more like editing a text file with a single application of a
| regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
| anthk wrote:
| So, Perl or sed. If it's Perl, the guy from XKCD was right.
| And, maybe, Larry Wall.
| xarope wrote:
| TIL my years of perl regex'ing was preparing me for a
| future of DNA gene warfare
|
| (core war, anybody?)
| duskwuff wrote:
| I don't know if it still is, but, for a while, Perl was
| actually fairly popular in bioinformatics:
| https://bioperl.org/
| koeng wrote:
| It's fundamentally different than a computer and arguably
| more complete.
|
| The talk of "crawling along the genome" is kinda
| fundamentally wrong though and is a bit irking - CRISPR kinda
| just bumps around until it hits a PAM site, in which case it
| starts checking against sgRNA. Much more random than they
| make it seem
| anthk wrote:
| This is crazier: https://www.sciencealert.com/are-we-all-
| quantum-computers-wi...
|
| About CRISP, it's like the ultimate Perl+Regex for the
| body.
| dagurp wrote:
| sounds more like sed
| anthk wrote:
| Perl and awk can do everything sed(1) does, but it an
| easier way.
| drjasonharrison wrote:
| "Bumps around until it hits" sounds like a set of magnets
| arranged to only mate up in a specific direction. Except we
| have four nucleotides rather than only two magnetic poles.
| Robotbeat wrote:
| Yeah, in some ways, the genetic code and molecular biology
| around transcription, etc, more closely resembles the
| abstract Turing Machine than an actual computer does.
| Absolutely fascinating that the messy world of biology ends
| up being pretty analogous to the clean world of binary logic.
| Gene sizes are expressed in kilobases, where a base carries 2
| bits of information.
| davedx wrote:
| Sounds kind of like the infinite tape machine....
| mr_toad wrote:
| About 6 billion letters in human DNA.
| buzzy_hacker wrote:
| Made me think of It was only in college,
| when I read Douglas Hofstadter's Godel, Escher, Bach, that I
| came to understand cells as recursively self-modifying
| programs. The language alone was evocative. It suggested that
| the embryo--DNA making RNA, RNA making protein, protein
| regulating the transcription of DNA into RNA--was like a
| small Lisp program, with macros begetting macros begetting
| macros, the source code containing within it all of the
| instructions required for life on Earth. Could anything more
| interesting be imagined? Someone should have
| said this to me: > Imagine a flashy spaceship
| lands in your backyard. The door opens and you are invited to
| investigate everything to see what you can learn. The
| technology is clearly millions of years beyond what we can
| make. > > This is biology.
| -Bert Hubert, "Our Amazing Immune System"
|
| from https://jsomers.net/i-should-have-loved-biology/
| duskwuff wrote:
| >> Imagine a flashy spaceship
|
| I misread this as "fleshy" for a moment, and the quote
| almost works better that way.
| floam wrote:
| Me too. It did. Huh.
| dekhn wrote:
| This system isn't really turing complete, but existing
| biology provides everything required to make a computer which
| is Turing complete (assuming non-infinite tape size).
|
| True programmatic biology is still very underdeveloped. I
| have seen logic gates, memory, and state machines all
| implemented, but I don't think anybody has built somethign
| with a straightforward instruction set, program counter,
| addressable RAM, and registers that was useful enough to
| justify advanced research.
| joshmarlow wrote:
| If this thread interests you, you should check out "Blood
| Music" by Greg Bear. It's pretty old but the premise is that
| a researcher 'closes the loop' in a bunch of cells by making
| them able to edit their own DNA - thus making them Turing
| Complete.
|
| Hilarity subsequently ensues.
| dekhn wrote:
| Cells are already able to edit their own DNA. Examples
| include the yeast mating switch, in which the "active" gene
| is replaced by one of two templates, determining the role
| the yeast plays in mating (https://en.wikipedia.org/wiki/Ma
| ting_of_yeast#Mechanics_of_t...)
|
| Further, your immune system does some clever combinatorial
| swapping to achieve diversity
| (https://en.wikipedia.org/wiki/V(D)J_recombination). The
| generated diversity is then screened by the immune system
| to find highly effective antibodies that bind to specific
| foreign invaders.
|
| Doing something actually interesting from an engineering
| perspective makes for fun science fiction, but as always,
| the specific details in that story would be a very unlikely
| outcome.
| xarope wrote:
| As I get older, I'd be happy with some minor incremental
| progress on addressing myopia and hyperopia.
| Balgair wrote:
| One other fun part of gene editing _in vivo_ is that we don 't
| actually use GACU (T in DNA). It turns out that if you use
| Pseudouridine (Ps) instead of uridine (U) then the body's
| immune system doesn't nearly alarm as much, as it doesn't
| really see that mRNA as quite so dangerous. _But_ , the RNA ->
| Protein equipment will just make protiens it without any
| problems.
|
| Which, yeah, that's a _miraculous_ discovery. And it was well
| worth the 2023 Nobel in Medicine.
|
| Like, the whole system for gene editing _in vivo_ that we 've
| developed is just crazy little discovery after crazy little
| discovery. It's all sooooo freakin' cool.
|
| https://en.wikipedia.org/wiki/Pseudouridine
| Teever wrote:
| I suppose a downside (depending on your perspective) of this
| is that it will make people who are genetically modified in
| this fashion trivial to detect.
|
| That's good if your goals are to detect genetic modification
| which may be considered cheating in competitive sports.
|
| That's bad if your goals are to detect genetically modified
| people and discriminate against them.
|
| I see a near future where the kind of people who loathe
| things like vaccines and genuinely believe that vaccines can
| spread illness to the non-vaccinated feel the same way about
| other things like genetic modification and use legal
| mechanisms to discriminate and persecute people who are
| genetically modified.
| ale42 wrote:
| > it will make people who are genetically modified in this
| fashion trivial to detect.
|
| I'm not totally sure. If I understand it correctly, the
| mRNA contains pseudouridine, and it makes the protein that
| will edit the DNA. The edited DNA should look like a normal
| one.
| Teever wrote:
| Ah. That makes sense. My mistake.
| LawrenceKerr wrote:
| If you're going to make the comparison with vaccines, and
| if history is any indication, the more realistic worry
| would be the other way around (since that's where the money
| is): that genetic modifications will be mandated, and that
| those who object will be discriminated against.
|
| [And no, I am not anti-vax, nor anti-gene-editing.]
| khazhoux wrote:
| "What do you mean you haven't modified your chromosome 7
| CFTR gene? _And you're planning to have children???_ "
| kulahan wrote:
| It wouldn't be crazy if I teleported 50 years in the
| future and heard someone tell me that not doing this is
| akin to child abuse. Obviously all suffering is relative,
| etc. etc., but it's just interesting to imagine a world
| where the societal pressure to make a perfect child is
| high.
| _whiteCaps_ wrote:
| I don't know anything about gene editing, but my
| grandmother was a carrier of the BRCA mutation. It would
| have saved a lot of heartbreak in my family if that could
| have been detected and repaired. My aunt, mom, and
| brother (age 4) all died of cancer. I'm just glad that my
| mom didn't know she had the mutation and passed it on to
| her child.
| sfink wrote:
| Careful with qualifiers there. I genuinely believe that
| vaccines can spread illness to the non-vaccinated, since it
| has happened many times and is well-documented. For
| example, it's why only the inactivated (aka "dead" virus)
| polio vaccine has been used in the US since 2000.
|
| I'm not arguing about whether the risks of the attenuated
| virus outweigh the benefits. I think the data are very
| clear there. (Heh -- and I'm sure the vast majority of
| people will agree with that statement, even if they
| disagree on what the clear answer is....)
|
| It's just that one shouldn't mock a belief without
| including the necessary qualifiers, as otherwise you're
| setting up an argument that can be invalidated by being
| shown to be factually incorrect.
|
| As for genetic modification of humans, IMO there are a lot
| of very good reasons to be wary, most of them social. Fatal
| hereditary conditions are obviously an easy call. What
| about autism (not saying there's a genetic link there to
| use, just a what if)? Or other neurodivergence? Like being
| a troublemaker in class? Or voting for the party that
| doesn't control the medical incentive structure? Heck,
| let's stick with the fatal hereditary conditions, and say
| the editing does not affect germ cells. Is it ok if the
| human race gradually becomes dependent on gene editing to
| produce viable offspring? Or let's say it does extend to
| germ cells. The population with resources becomes
| genetically superior (eg in the sense of natural lifespan
| and lower medical costs) to those without, creating a solid
| scientific rationale for eugenics. Think of it as redlining
| carved into our blood.
|
| I don't think discrimination against the genetically
| modified is the only potential problem here.
|
| As humans, we'll deal with these problems the way we've
| dealt with everything else transformational. Namely: very,
| very badly.
| catigula wrote:
| I mean, I feel like autism is a terrible example here,
| it's not just some quirky personality trait, it's a
| reality people live with that runs the gamut from
| difficult to completely debilitating. Even the more mild
| forms of autism cause extreme difficulty in many aspects
| of life. If that was curable or preventable, that'd be
| great.
|
| If it turns out some pathogen or chemical made me
| autistic, regardless of whether or not I could be cured
| as an adult, I'd have certainly preferred to live the
| reality where I had been as a child.
| sfink wrote:
| Sure, the purpose was to illustrate a slippery slope, and
| curing autism is meant to be more obviously good than
| abolishing all forms of neurodivergence but less
| obviously good than fixing fatal hereditary diseases.
|
| I'm not going to claim that I know the perfect place to
| draw the line.
| zmmmmm wrote:
| I think a better reason autism is a bad example is that
| part of its definition is that it is a consequence of
| fundamental brain structure and development
| (differentiating it from other psychological disorders
| which are acquired and more malleable). These aren't
| things you will "undo" with some gene edits. The whole
| brain has developed in a different way. Short of re-
| growing them a new brain you aren't going to change that
| (assuming you wanted to).
| kulahan wrote:
| I think scientists have believed for a while that any
| type of "autism cure" would need to be extremely early
| intervention for maximum effectiveness for exactly this
| reason. I remember speaking with a team that was studying
| detection of autism in the womb for this exact reason.
| jcims wrote:
| >...and say the editing does not affect germ cells.
|
| To me the wildest scenarios take this off the table.
| mr_toad wrote:
| > vaccines can spread illness to the non-vaccinated,
| since it has happened many times and is well-documented
|
| Nothing in medicine is certain. Nearly any medical
| treatment has a small chance it could kill you. There's a
| small, but non-zero chance of a lethal infection even if
| they injected you with saline, odds that rise
| dramatically in less than sanitary conditions.
|
| Ironically the use of the attenuated oral vaccine for
| polio was because of the risk of infection in places
| where the availability of sterile syringes was hard to
| guarantee. It's all about the relative odds.
| nuc1e0n wrote:
| At one time organ transplants were considered an ethical
| grey area (perhaps they still are by some), but I think
| most people now would consider it better to save lives in
| such a manner when it only brings help to those who need
| it and it's possible to, compared to the alternative.
| Having the capability may mean that things like organ
| theft now exist, but the benefits around the world
| outweigh the nastiness that has always come as part of
| human nature.
| sfink wrote:
| I agree that organ transplants are a net positive, and in
| fact are far less susceptible to unintended consequences
| (there's a pretty low limit to the number of organs and
| operations involved, for one.)
|
| I also think that gene repair is a net positive. I would
| just like us to, for once, look ahead and foresee some of
| the foreseeable consequences and act to mitigate them
| _before_ the bulk of the damage is done.
|
| I don't think it's necessary to slow the development;
| gene therapy is too desperately needed, and slowing it
| down so that we can prepare is not going to cause us to
| prepare.
| prisenco wrote:
| I'm less interested in detecting genetic modification for
| the purposes of discrimination than making sure it's
| available to everyone.
|
| Assuming requisite safety of course.
| ddq wrote:
| I'm more concerned about the possible negative unintended
| consequences of making it available to everyone first.
| Genetic modification is well-explored Pandora's Box in
| science fiction and present humanity seems so ill-
| equipped in collective philosophy and reason to handle a
| paradigm shift of that magnitude.
| jillyboel wrote:
| Don't be silly, the rich will want their babies to be
| perfect so gene editing will be legal and considered OK.
| _bin_ wrote:
| Can you explain why this is a bad thing, or is it just
| ""the rich" bad"?
| jhickok wrote:
| Not OP, but presumably it's because it could cement a
| permanent divide between classes. We still have quite a
| bit of upward mobility in the US, but health is a
| tremendous predictor of future outcomes, so gating that
| to the rich is dangerous to the stability of society in
| that way.
| _bin_ wrote:
| This seems like more of an issue with accessibility of
| the treatment than the treatment itself
|
| If we could make most children smart, productive,
| ambitious, courteous, civil, conscientious, honorable,
| strong... the value to society is probably high enough to
| justify covering it for almost anyone.
| boroboro4 wrote:
| The society already can invest a lot (through public
| education) to "make most children smart, productive,
| ambitious ...".
|
| Somehow society (or indeed parts of it) decided to use it
| as a tool of further segregation rather than overall
| prosperity. I'm afraid same might apply to this.
| _bin_ wrote:
| We "invest" more than almost anyone. 38% higher than the
| OECD average. I don't find discussions about throwing
| more money at the problem to be constructive so much as a
| way to ignore other issues at play.
|
| I don't really see how this affects e.g. what I do for my
| children. I will absolutely be turning them into the
| closest to superhuman the current state of treatments
| lets me, traveling internationally if I need to. If
| someone else decides to segregate access to treatment,
| that is a separate, wrong act that will not hold me back
| from giving my children every advantage possible.
|
| (Yes, I understand this is a positional arms race, but 1.
| that doesn't change the individually-optimal outcome, and
| 2. that doesn't change that society net benefits from
| it.)
| boroboro4 wrote:
| I don't mean to invest as to spend more money, rather to
| spend money better and in a more equal way. While USA
| spends a lot of money on education I don't think it
| translates in better education on average. Even if this
| was beneficial for the society in general.
|
| I am, afraid, that this kind of genome modification will
| further increase divide in a society and turn social
| lifts off even more. I.e. it's not gonna be your kid to
| get "improve" brain genes first, and later your kid
| wouldn't get a chance to get it ever again for their
| children.
|
| Just to be clear I'm not against of the progress, this
| thing is fascinating and really shows how awesome humans
| are. And I get why you'll get it if possible for your
| kid. I'm just not sure its benefits for the society mean
| it's gonna be anyhow affordable for regular people.
| _bin_ wrote:
| You will have a really hard time convincing Americans to
| keep paying high taxes while funding is pulled from their
| children's schools and redistributed to inner cities and
| ruralia. My observations suggest the problem for the
| latter isn't financial.
| concordDance wrote:
| This is already true to a great extent. A family with
| lots of genetic health conditions are probably going to
| remain poor.
| jillyboel wrote:
| I'm explaining that gene modification will not be
| considered illegal or bad because the rich will have a
| vested interest in it being legal. This is a reply to GP
| saying:
|
| > use legal mechanisms to discriminate and persecute
| people who are genetically modified
|
| I believe there is no way this will happen, because legal
| mechanisms are driven by the whims of the rich, and they
| will want gene editing to be legal. So there will beno
| legal mechanisms to discriminate against those who have
| been edited.
| junon wrote:
| RNA is a byproduct, not a "source of truth" in technical
| terms. The DNA is. DNA is converted to RNA and then
| executed and then discarded, per my understanding. The DNA
| is still AGCT.
| alecco wrote:
| > [...] then the body's immune system doesn't nearly alarm as
| much, as it doesn't really see that mRNA as quite so
| dangerous
|
| Please tell me there are measures to prevent this going into
| the wild. Please tell me this won't be used in large-scale
| industrial farming.
| imcritic wrote:
| Farming? This will be used in warfare.
| Balgair wrote:
| Not under the current way we do things, I don't imagine.
|
| So the real trick here isn't the mRNA, it's the
| nanobubbles. Basically, you're putting these bits of mRNA
| into these little fat bubbles and then injecting those
| into the blood. Making those bubble shelf stable is
| _really hard_ , hence the issues with temperature and the
| covid vaccine. To then make those little fat bubbles
| stable-ish in the blood is also a really hard thing to
| do. They have to get to the right places (in this baby's
| case, the liver) and then degrade there, drop off the
| mRNA, and not mess up other tissues all that much. Like,
| it's not terrible to make these micelles degrade _in
| vivo_ , but to have them do that _and_ not degrade in the
| tubes, ... wow... that is _really_ difficult. There 's a
| reason that Moderna is so highly valued, and it's these
| bubbles.
|
| To try to then put these in a weapon that could do this
| though the airways would be, like, nearly impossible.
| Like, as in I think the second law of thermodynamics, let
| alone biology, and then simple industrial countermeasure
| like a N95 respirator, yeah, I think all of that makes it
| pretty much impossible to weaponize.
|
| (Hedging my bets here: I don't know if they had to do all
| that with this baby, as you can kinda go from lab to baby
| really fast, since it's such a special case. But for mRNA
| based vaccines and cancer treatments, you have to deal
| with the shelf stable issue)
|
| (Also, other bio people, yes, I am trying to explain to
| laymen here. Please chime in and tell me how I'm wrong
| here)
| okayishdefaults wrote:
| I think it doesn't need to be a direct weapon to be used
| in warfare. You can genetically modify your own military.
| Balgair wrote:
| Yeah good point!
|
| Something that a lot of people are unaware of is that US
| Military is allowed to do this. I forget the exact EO,
| but it was signed by Clinton and is in the 12333 chain of
| EOs. Mostly, this is used for the Anthrax vaccine. But,
| it does give clearance to do other forms of medical
| experimentation on warfighters.
|
| No, really, I am serious here. This is true. I may have
| the details a bit off, so sorry there, but they can and
| do preform medical experiments on people without their
| consent. Now, to be fair, France does this too. They do
| sham surgeries over there. Non-consenting human medical
| experimentation is quite the rabbit-hole.
|
| So, I can kinda see in the next 10 years, certainly the
| next 50, a routine shot given to warfighters to help them
| with things like blood loss, or vitamin C production, or
| fast twitch muscles, or whatever. The legal framework is
| already there and has been for a while, it's just an
| efficacy issue, honestly.
| Muromec wrote:
| That would be less effective than bio and chemical
| weapons are. Which are not used because they just suck
| kulahan wrote:
| I'm not sure of by "they just suck" you meant to imply
| that they're ineffective. If that's the case, I strongly
| disagree. They are not used because somehow all countries
| pretty much agreed they're way TOO effective and
| horrific. Nobody wants it used on them, so nobody uses it
| on anyone else.
|
| I cannot imagine a more effective weapon than an
| invisible gas that melts you alive, and there are MANY
| chemical and bio examples of these types of weapons.
| beeflet wrote:
| The ceiling for the destruction caused by biological
| weapons is far greater than chemical weapons. There is no
| chemical weapon that can hijack the victim to make more
| of it.
| wffurr wrote:
| >> They are not used because somehow all countries pretty
| much agreed they're way TOO effective and horrific
|
| That's the story but it doesn't hold up. Chemical weapons
| were used as recently as the Syrian civil war. I also
| think if they were really effective in modern warfare,
| Russia would have long ago deployed them in Ukraine.
|
| More here: https://acoup.blog/2020/03/20/collections-why-
| dont-we-use-ch...
| kulahan wrote:
| What do you mean "if they were really effective"? We
| still hand out CBRN gear and train in how to put
| necessary parts on in seconds, because that's often how
| little time you get before you're permanently
| incapacitated. Mustard gas alone should prove this, and
| that's an OLD chemical weapon.
|
| Nowadays we have riot control agents that can be tailored
| to demographics, react more violently in the presence of
| sweat, or contain psychoactive ingredients. Nanoparticle
| dispersion bypasses common gas masks and clothing
| protection. Even if you're completely geared up, they can
| be engineered to last on surfaces for a long time, or
| react only in the presence of certain triggers. Imagine
| thinking you're safe until someone turns on a certain
| light bulb and you cook inside your protective gear
| because you were actually exposed 12 hours earlier in an
| undetectable manner.
| wffurr wrote:
| I'd encourage you to read the article. Chemical weapons
| are effectively useless against a well-trained "modern
| system" army. Part of that is the chemical warfare
| equipment and vehicles, but mostly it's cover-and-
| concealment. If you can actually find the enemy, it's
| much faster and simpler to use the other vastly
| destructive munitions that modern militaries have.
| kulahan wrote:
| I did, and it's really not very convincing at all. It
| uses an example where a terror group in Japan was able to
| injure thousands of people with a chemical attack, and
| act as if this is... not a particularly effective
| outcome?
|
| Additionally, that "if you can find them" is doing some
| pretty heavy lifting. The range of explosives and
| kinetics is hilariously low, and the actual percentage of
| your military with the level of mobility he seems to be
| referring to is infinitesimal.
|
| This argument more correctly explains why chemical
| weapons aren't a great defense against precision strike
| groups. It also doesn't get into detail with concepts
| like dropping a bomb right in the middle of a firefight
| knowing it literally cannot harm your own troops, short
| of the physical metal accidentally falling on one of your
| own troops.
| wffurr wrote:
| >> a terror group in Japan was able to injure thousands
| of people with a chemical attack
|
| A terror attack on civilians is a lot different than
| modern militaries using them on each other.
| Balgair wrote:
| Yeah, it's not a drama.
|
| The reason that the body doesn't alarm as much to
| Pseudouridine, is that it's not a 'natural' RNA base.
| Meaning that, for the most part, nature really never uses
| it and so we haven't evolved to look out for it. Nature
| uses Uridine and so immune systems have evolved to look out
| for random bits of RNA in the body that use it and then
| clean that all up.
|
| It's like if you're looking to clean up legos in you house
| with a romba that only cleans up legos. And all of a sudden
| it finds a duplo. It's going to take a hot second to figure
| out what to do with the duplo. And in that time, you can
| sneak by and build a duplo fort. (Look, I know this analogy
| is bad, but it's the best I can come up with on the fly,
| sorry. If anyone else wnats to come up with a better one,
| please do!).
|
| The Pseudouridine is used up and degraded very quickly
| inside the cell, minutes at the very very longest, more
| like microseconds. It's just part of a messenger (the 'm'
| in 'mRNA') to tell the cell to do things.
|
| You might see mRNA gene editing in factory farms, but it
| would just be easier to do germline editing instead and
| skip spraying animals, plants, and fungi. Why waste the
| equipment, right?
| kulahan wrote:
| I thought the analogy was good. They're meant to be
| simple and easy to understand, not perfect
| representations.
| abracadaniel wrote:
| As I understand it, there is nothing in nature that can
| create it, so the mRNA can never be accidentally
| replicated. It's a safety mechanism that prevents escape.
| treyd wrote:
| Industrial farming of what?
| slashdev wrote:
| Why would it be used in farming, you can edit the DNA
| before fertilization in farming, no need to do anything in
| vivo.
| monkeycantype wrote:
| I remember from a few few years back that the lipid coating
| may have caused problems for the liver, when treating people
| for diseases that needed to target a lot of tissue, such as
| muscle disorders. Is that still the case?
| Balgair wrote:
| Unfortunately, I do not know. Sorry here.
|
| If anyone else does know, please chime in!
| mike_hearn wrote:
| You remember correctly. Moderna had a lot of problems with
| their drug trials due to the lipid nanoparticles they were
| using to transport mRNA. They were toxic to the liver upon
| repeat dosings. Unfortunately, it appears they never found
| a fix for the problem. Instead they gave up and found a
| "business solution" by pivoting from drugs to the (at the
| time) less profitable vaccines, on the grounds that
| vaccines are something you only need to take once so the
| toxicity issue could be dodged. Doh. That was in 2017.
|
| https://www.statnews.com/2017/01/10/moderna-trouble-mrna/
|
| By the time COVID vaccines came around a few years later
| there was no evidence they had fixed the problems with
| lipid nanoparticle delivery. I looked for such evidence
| extensively at the time, for example, announcements by
| Moderna of breakthroughs or trials of new drugs. Today the
| situation seems not much different. Note that Moderna's
| wikipedia article has a section on "rare disease
| therapeutics" but it's literally empty:
|
| https://en.wikipedia.org/wiki/Moderna#Rare_disease_therapeu
| t...
|
| Because of their failure to progress beyond COVID vaccines
| Moderna's share price got slaughtered, falling from a peak
| of ~$450 to ~$25 today.
|
| I don't know if other companies were able to find
| breakthroughs here, after COVID I stopped following the
| topic. Unfortunately, although mRNA tech has great
| potential, when normal safety standards were reimposed it
| appears that Moderna went back to being unable to make
| anything safe enough to launch.
| Jugurtha wrote:
| What was the success of other means, such as sugars and
| proteins? Something like glycocalyx or polysaccharide
| capsules? Or HIV like deployment gp41/gp120?
| Gareth321 wrote:
| > on the grounds that vaccines are something you only
| need to take once so the toxicity issue could be dodged
|
| But we didn't take these vaccines once. We took many of
| them. Am I to understand a known side effect is liver
| toxicity for multiple doses?
| mike_hearn wrote:
| You have successfully read between the lines, yes.
| Avamander wrote:
| They have not.
| popol12 wrote:
| I guess the issue is not about taking the medicine once
| vs twice, but rather << a few times >> vs << daily >>
| heavyset_go wrote:
| Toxicity depends on dose. COVID vaccines just need
| micrograms of material to induce an immune response, I
| imagine it takes more than that to edit the genes of a
| large organ.
| mike_hearn wrote:
| There have sadly been cases where the vaccines did
| perform unintended gene editing. It shows up as people
| whose bodies are still producing spike protein months or
| years after vaccination.
| floam wrote:
| Are you saying that there are cases of longer than
| expected spike protein presence where these cases are
| actually because gene editing took place?
| maxerickson wrote:
| Is this a troll? Pseudouridine mRNA isn't gene editing.
| VierScar wrote:
| What do you mean? Is mRNA not used to produce the enzyme
| that these comments mentioned? I don't think they were
| saying mRNA is gene editing itself. Just commenting on a
| modified mRNA helping the process compared to normal mRNA.
| Might be misunderstanding though so correct me if I am
| maxerickson wrote:
| I dunno, I think they are being sloppy and conflating
| things. We can induce manufacture of proteins and can
| design proteins that carry out gene editing, so we can
| stack that knowledge together to induce cells to
| manufacture proteins that carry out gene edits, but it's
| the payload that is the gene editing, not the instruction
| to make the protein.
|
| Given the merry movement to call the COVID vaccines gene
| editing, it rankles.
| Balgair wrote:
| Hey, yeah, I'm not the most up to date on the current
| methods. Most of my knowhow is a bit out of date here. So
| thanks for piping up to correct things.
|
| Do you know of any good resources that I can use to get
| up to speed on the exact methods they used for the baby?
|
| My understanding, outdated as it is, is that we're using
| the mRNA to go in and create CRISPR-CAS9 slicers/dicers
| and additionally to that, the correct genes (not mRNA) to
| get stitched in. I would love to know more about how I am
| wrong here, as I am sure I'm not even close to really
| understanding it.
|
| Thanks!
| ionwake wrote:
| I think you're replying to someone edgelord about covid
| who got confused about some mrna statement and then back
| pedalled re-affirming what the article was about.
| cm2187 wrote:
| That also sounds like a recipe for a terrifying virus
| dtpro20 wrote:
| It's almost exactly the premise of the movie "I am Legend,"
| But it uses CRISPR instead of a Virus as the delivery
| mechanism.
| vanderZwan wrote:
| I would be surprised if viruses using U instead of T didn't
| already exist. After all, don't _all_ viruses work by doing
| gene editing in vivo, except just localized to one cell?
|
| EDIT: well, I suppose the question is whether cells of
| living beings could produce the U required for the viruses.
| But if not, then a wild virus using U instead of T to
| bypass our immunity also would not be a threat for that
| very reason.
| snalty wrote:
| It's not the use of Uracil/Urimidine that bypasses the
| immune system. RNA uses Uracil instead of thymine in all
| organisms afaik, and RNA viruses certainly exist. It's
| pseudouridine that's the magic stuff.
| dapf wrote:
| It sounds like Spiderman tech.
| teekert wrote:
| I feel a bit proud that humanity healed a baby with this
| tech before any viruses were constructed/released.
| Symmetry wrote:
| It would allow a synthetic virus to get a foothold in your
| cells more easily, but our cells don't make Pseudouridine
| naturally which throws a big wrench in the ability of a
| virus to copy itself. And without replication you don't
| have a serious infection.
| shiandow wrote:
| I don't thnk the body has a way of making mRNA with
| pseudouridine.
| xkcd1963 wrote:
| Wow that could be also abused by some future covid-lab to
| bypass immunesystem and modify the DNA so the body
| disfunctions
| Balgair wrote:
| Yeah, I mention this in some other comments that got greyed
| out.
|
| Basically, the real deal technology here is the lipid
| bubbles that deliver the payloads to the right cells, not
| the base modification. You can go look at them, and a lot
| of other comments in this thread for more info on that
| tech.
|
| TLDR: No way that anyone can bypass anything. These lipid
| bubbles are a miracle that they work at all; they're so
| unstable, it boggles the mind we can even use them to begin
| with. Doing any large scale DNA editing on an unsuspecting
| population would be so insanely expensive and difficult, I
| certain moving to the Moon would be cheaper.
| shadowgovt wrote:
| Gene therapies are pretty incredible. Some of them are still
| making a button-hole with a machete, but that's relative to the
| previous medical intervention of a button-hole with a tank's
| main gun.
|
| One of the treatments for sickle-cell involves switching off
| the gene that makes the malfunctioning red blood cells, but of
| course that's not sufficient; you'd stop making red blood cells
| completely and you'd die. So it's combined with a modification
| that switches _on_ a gene that all humans express pre-birth
| that causes your body to make "super-blood": red blood cells
| with significantly more binding points for oxygen. This is
| necessary because a fetus gets oxygen from its mother's blood,
| so the increased binding affinity is useful for pulling the
| oxygen towards the fetus at the placental interface. After
| birth, expression of that gene is disabled and regular RBC
| genes switch on.
|
| So the therapy doesn't "fix" sickle RBCs; it disables the
| body's ability to make them and re-enables fetal RBCs! I have
| seen no literature on whether having fetal RBCs in adulthood
| has any benefits or drawbacks (besides changing the affinity
| ratio for their fetus if the patient gets pregnant, I imagine
| increased-affinity RBC could help for athletics... But I also
| imagine it requires more iron to generate them so has dietary
| impact).
| nomadpenguin wrote:
| High affinity RBCs would actually be a disadvantage for
| athletics. You actually don't need very high affinity to pick
| up oxygen from the lungs -- your lungs are comparatively
| extremely high in oxygen. What matters more is being able to
| drop the oxygen off in peripheral tissues. Higher affinity
| means that it's harder to actually deliver the oxygen, which
| is why we evolutionarily developed the switch away from fetal
| hemoglobin.
| philsnow wrote:
| I thought the evolutionary impetus for fetal hemoglobin was
| because it greatly increases the efficiency of fetal oxygen
| uptake across the placental interface?
|
| From shadowgovt:
|
| > I have seen no literature on whether having fetal RBCs in
| adulthood has any benefits or drawbacks (besides changing
| the affinity ratio for their fetus if the patient gets
| pregnant
|
| This was exactly the question that popped into my mind when
| I read about switching from normal adult RBCs to fetal
| RBCs: does this therapy reduce the likelihood of carrying a
| baby to term?
| nomadpenguin wrote:
| Yes, that is true. I phrased that badly -- it's more that
| we didn't take the evolutionary branch where we retain
| the fetal hemoglobin because it is maladaptive in adults.
| anon291 wrote:
| I have natural persistence of fetal hemoglobin which
| counteracts my inherited thalassemia trait.
|
| No problems really..never knew I had it until I was told I
| had thalassemia trait as part of genetic testing. My
| hemoglobin panel shows fetal hemoglobin.
| j45 wrote:
| Appreciate the explanations and the analogies.
| jjtheblunt wrote:
| > That is one of the most incredible things I have ever read.
|
| This is even more great reading behind the above:
|
| https://en.wikipedia.org/wiki/Jennifer_Doudna
| bengale wrote:
| Walter Isaacson's book "The Code Breaker" is about this
| subject. I couldn't put it down.
| beoberha wrote:
| All his books are like that. The Innovators is my personal
| favorite.
| ascorbic wrote:
| A rare case where the list of awards she's received is so
| long it needs a separate Wikipedia page https://en.wikipedia.
| org/wiki/List_of_awards_and_honors_rece...
| jcims wrote:
| She's got a couple of great appearances on RadioLab.
| jjtheblunt wrote:
| Also
|
| https://en.m.wikipedia.org/wiki/Emmanuelle_Charpentier
| lysace wrote:
| They shared the Nobel prize for CRISPR. Yet you chose to
| lead with the American one. :/
| jjtheblunt wrote:
| That's because the link I shared immediately cites Doudna
| and Charpentier as a team.
|
| After edits were disabled, I thought perhaps there's a
| page for Charpentier too, which there was, but later than
| i could edit.
|
| They're both amazing scientists.
| amelius wrote:
| A darker passage in the history of gene editing, but still an
| interesting story and something not to forget:
|
| https://www.sciencehistory.org/stories/magazine/the-death-
| of...
| fsndz wrote:
| Never bet against science !
| znpy wrote:
| Yep, this is truly incredible!
| ac29 wrote:
| > To accomplish that feat, the treatment is wrapped in fatty
| lipid molecules to protect it from degradation in the blood on
| its way to the liver, where the edit will be made. Inside the
| lipids are instructions that command the cells to produce an
| enzyme that edits the gene.
|
| This isnt entirely unlike the method mRNA vaccines use. Through
| some clever biochemistry, mRNA vaccines get bits of code into
| cells where the cell's built in code compilers manufacture
| proteins that induce immunity.
|
| We have developed software patches for our biology.
| _heimdall wrote:
| I know someone well who works in this space, personalized gene
| therapy as cancer treatment.
|
| > until it finds the exact DNA letter that needs to be changed.
|
| This pine is disingenuous (at best). There is no way of
| guaranteeing where the DNA is inserted. It is designed to only
| slot into a very specific portion of the DNA but they don't
| have a way to control that precisely, the accuracy is high but
| "exact DNA letter" is skipping over a few pretty important
| details.
|
| To be clear I'm not saying it is ineffective or unsafe, only
| that the claim made is marketing speak and not actually true.
| Thebroser wrote:
| The approach they used which is base editing doesn't actually
| insert or remove DNA, it actually uses an enzyme to convert
| one base to another, which is much safer as this doesn't
| require a double strand break in DNA:
| https://blog.addgene.org/single-base-editing-with-crispr
| _heimdall wrote:
| That is interesting, I didn't catch the difference my first
| time through the article.
|
| I do still question their claim of 100% precise results
| though. At least based on that high level description I can
| definitely see it being safer, but I question any
| scientific claim that is an absolute.
|
| Specific to the editing vs insertion mechanism, I question
| how it doesn't run into similar constraints where the
| mechanics of targeting exact portions of the DNA can
| occasionally miss or impact the wrong segment of DNA
| entirely.
|
| I haven't dug as deeply down the base pair conversion
| though, so I could absolutely be wrong!
| yieldcrv wrote:
| Running this article through GPT and asking it more questions
| is one of the most incredible allocations of productivity I
| have ever seen
| dclowd9901 wrote:
| I literally said the same thing out loud.
|
| I had heard about CRISPR a while back but most reporting on it
| kind of hand waved over the mechanisms of how it actually
| accomplishes its work. What these researchers have figured out
| to make this work absolutely blows my mind.
| j16sdiz wrote:
| AFAICT, CRISPR still make many bad edits. We relies on the
| fact that most of those bad edit won't survive.
| rubidium wrote:
| It can make "bad edits" eg off target effects. But in this
| case there were, as far as is known, none. It's aided that
| this was a single nucleotide defect.
|
| They specifically tested for off target edits in the mouse
| study and found no harmful edits (and very rare off target
| ones). That plus the specific targeting of the liver cells
| (no germ line effect expected), makes this a low risk
| approach and certainly better than doing nothing.
| cryptoegorophy wrote:
| How does it know how to gps around? From what I know everything
| down there is a chemical reaction with some minimal physical
| motion, but how do you program it to know where to change and
| what and how.
| TheJoeMan wrote:
| It's more like a "ctrl+F" for DNA. Hopefully there's only 1
| match (the target site).
| 0x1ceb00da wrote:
| So you create a molecule that binds to a certain location
| in the dna, and then deploy a billion of them?
| rubidium wrote:
| More or less, yes.
|
| An interesting part of the study was determining what a
| clinical dose _should_ be. You need enough to edit enough
| liver cells. But don't really want to completely overdo
| it to limit potentially negative side effects. Seems like
| they got it right enough here, with the first dose having
| some effect and the subsequent dose having more.
| Tuna-Fish wrote:
| You need billions to cover multiple cells, you don't need
| many for a cell.
|
| The counterintuitive part is how fast thermal motion is
| relative to the size of dna.
|
| In body temperature water, the thermal velocity of water
| molecules jostling around everything is ~600m/s. The
| nucleus of a human cell is ~6um in diameter. That is,
| your average water molecule bounces around at a speed
| that makes it move from one end of the nucleus to another
| roughly 100 million times per second.
|
| Larger molecules move more slowly, but they still zip
| around fast enough that nothing needs to "seek" to a
| specific position in a cell to get there, everything will
| touch everything just from thermal random walk in a very
| short time. So how biology works is that inside the cell
| there might be just one messenger, which will have to hit
| a specific piece of dna just right in order to do
| anything, but that's still nearly instantaneous from our
| perspective.
| dtpro20 wrote:
| Well its more like search and replace, where you cross your
| fingers that it only replaces the words you are trying
| replace without impacting the rest of the text in the
| document.
| Thebroser wrote:
| Add gene has a great guide as to what goes on at the
| molecular level: https://www.addgene.org/guides/crispr/
|
| Essentially you can design an rna molecular that contains a
| 20 nucleotide long sequence that can target your region of
| interest, with the caveat that there is a standard
| recognition sequence proximal to your sequence of interest
| (PAM sequence)
| bglazer wrote:
| It doesn't know anything about where it "needs" to go. One of
| the weirder and more unintuitive things about molecular
| biology is just how fast everything moves inside a cell. The
| CRISPR molecule diffuses from one side of the nucleus to the
| other in a couple seconds and probably bumps into the
| entirety of the genome in a matter of minutes or hours. It's
| very, very crowded inside cells, proteins and DNA and
| metabolites are constantly bumping into each other and are
| tumbling around at frankly incomprehensible rates. So,
| nothing needs to "know" where it needs to go, it simply gets
| pushed and jostled around until arrives there and then the
| attraction between the CRISPR's RNA and the DNA takes over
| drjasonharrison wrote:
| This sounds so much like "simulated annealing" with
| reactive components and almost no lack of energy in the
| system. Various energies/reactions occur, which unlock or
| lock out other possible reactions.
| vmurthy wrote:
| Cue the book "The Code Breaker" [0]. I read it a long time ago
| and such an incredible book and journey by Jennifer Doudna and
| Emmanuel Charpentier. Do check it out
|
| https://en.wikipedia.org/wiki/The_Code_Breaker
| ziofill wrote:
| A chemist friend of mine did his thesis on lipid vesicles, and
| I remember my mind being blown when he told me these are
| modelled as a liquid on the 2D plane of the membrane, but as a
| solid on the 1D orthogonal direction because the energy to swap
| two lipid molecules side by side is incredibly low (because it
| makes barely any difference), while the energy to swap them
| orthogonally to the membrane is much larger (because they would
| point in the wrong direction).
| ajkjk wrote:
| Oh that's neat
| verisimi wrote:
| Once the gene has been edited, things will work. But at some
| point that cell will die. Why would the replacement cell also
| have the edit? The DNA in the rest of the body's cells will
| still not be correct.
| riffraff wrote:
| When cells duplicate they have the same (altered) DNA so the
| mutated cells survive.
|
| You'll end up with mosaicism (cells with different DNA) but
| presumably you have enough of the new cells to fix the
| problem the original ones had.
|
| You don't need to fix all the body, you just need to fix some
| of the, say, liver, and you're good.
| esalman wrote:
| Thanks to DOGE you might read less and less about this kind of
| things.
| shafyy wrote:
| Unfortunately, this is true. From the article:
|
| > _The implications of the treatment go far beyond treating
| KJ, said Dr. Peter Marks, who was the Food and Drug
| Administration official overseeing gene-therapy regulation
| until he recently resigned over disagreements with Robert F.
| Kennedy Jr., the secretary of health and human services._
| pishpash wrote:
| Also presents a terrifying prospect of malicious use.
| DrScientist wrote:
| Bear in mind that they intentionally choose something that was
| soluble - ie the easiest thing possible. So it's doesn't mean
| everything is now solvable.
|
| For example it's no coincidence this is a liver disease as
| basically almost everything you inject in the bloodstream ends
| up concentrating in the liver by default - if you needed to
| target another organ with your LNP it would be much harder.
| Most of the time people are trying to stop stuff accumulating
| in the liver!
|
| The liver has other special properties that are helpful as
| well.
|
| Having said all that - it is still a massive achievement.
|
| > That is one of the most incredible things I have ever read.
|
| Biology is incredible - and you can do incredible things if you
| leverage it.
| abcd_f wrote:
| > that was soluble
|
| solvable
| DrScientist wrote:
| soluble has two meanings.
|
| - able to dissolve in solvent
|
| - able to be solved.
| jakeydus wrote:
| Huh, TIL!
| abcd_f wrote:
| Is the second meaning archaic?
| Den_VR wrote:
| You should have seen the homebrew guy's talk on DIY CRISPR
| where he injected himself on stage. And that was years ago.
| Incredible times for incredible work.
| harhargange wrote:
| I work on lipids and i myself didn't know they could be so much
| practically important.
| forgotpwagain wrote:
| Detailed New England Journal of Medicine article about this case:
| https://www.nejm.org/doi/full/10.1056/NEJMoa2504747
|
| And an Editorial piece (more technical than the NYT):
| https://www.nejm.org/doi/full/10.1056/NEJMe2505721
| caycep wrote:
| thanks for this, I think all these lay articles on biomedical
| news should definitely be accompanied by the paper
| bookofjoe wrote:
| I always try but way more often than not the paper is
| paywalled.
| n3uman wrote:
| One of the authors: Julia L Hacker
| vessenes wrote:
| NYT isn't super specific here, but they made it sound like the
| disease treated is liver related. My understanding is that the
| liver is a good place to start with CRISPR-type gene treatments,
| in that the liver normally deals with anomalous shit in your
| bloodstream, say, like CRISPR type edits. So anywhere outside the
| liver is going to be significantly harder to get really broad
| uptake of gene edits.
|
| It's crazy encouraging that this worked out for this kid, and I'm
| somewhat shocked this treatment was approved in the US - I don't
| think of us as very aggressive in areas like this. But to me,
| really hopeful and interesting.
| scotty79 wrote:
| I don't think it's gonna be that hard. All cells that blood
| reaches were happily taking mRNA vaccine.
| derektank wrote:
| I hate to break it to you, but it will be substantially more
| difficult to target other organ systems. The liver is
| uniquely easy to target with our current vectors.
|
| Right off the bat, the liver receives roughly a quarter of
| all cardiac output, either directly or second hand from the
| digestive organs. Additionally, the liver has a fenestrated
| endothelium which, while not completely unique in the body,
| uniquely allows molecules like lipid nanoparticles (LNPs) to
| access liver cells. Finally, the liver is the site of most
| lipoprotein processing, and LNPs can be designed to take
| advantage of the existing pathways to get the gene editing
| mRNA into the hepatocytes. All this is to say that if you
| have a genetic condition that primarily effects the liver,
| there's a lot more hope for treatment in the near term than
| for others.
|
| Good lecture on the difficulties of finding appropriate
| platforms for delivering gene therapies to cells for anyone
| interested [1]
|
| [1] https://youtu.be/6URTjoK58Yc
| XorNot wrote:
| No they were not. A vaccine triggers an immune response, not
| a functional change.
|
| mRNA vaccines are highly localized: you get a sore arm
| because most of it only gets taken up by muscle cells around
| the injection site, which spend some time producing the
| antigen and triggering a primary immune response (the
| inflammation aka the sore arm).
| scotty79 wrote:
| Still it needs to enter the cells all the same.
|
| As for being localized it's true however after vaccine dose
| S proteins have been detected also in remote locations in
| the body because you can't make something 100% localized.
|
| If you had an infusion that doesn't trigger immune system
| you could just increase the dose significantly, put it in
| the blood and most likely it would have reached all cells
| that blood reaches.
| im3w1l wrote:
| Last I heard those gene editing things lead to so called
| of-target edits, so they were basically corrupting random
| dna. Now in this case the baby would have died without
| this treatment so clearly benefits outweight the risks.
| But even then they probably want to have the dose be as
| low as possible.
|
| But I'm speculating a bit here.
| xrhobo wrote:
| What I find interesting about the covid mRNA vaccine is I
| remember being sick in March 2020 and I can't remember
| being sick since.
|
| I can remember getting a sniffle at night and waking up
| fine the next morning a few times.
|
| I think I had two doses of covid mRNA vaccine.
|
| I have actually forgot what it is like to be sick. It
| almost feels like the covid vaccine gave me some kind of
| super immunity. I never get the flu shot either. I have not
| had the flu in 5 years for sure.
| BrawnyBadger53 wrote:
| I think this is more likely a result of increased
| standards of cleanliness that have remained
| oceansky wrote:
| It is caused by a missing enzyme in the liver, yes.
| anarticle wrote:
| Specifically it is this:
| https://en.wikipedia.org/wiki/Carbamoyl_phosphate_synthetase...
|
| People born with this lack the enzyme CPS1, which screws up the
| urea cycle and causes a build up of ammonia. Ammonia build up
| is bad for your nervous system.
| cdcox wrote:
| You are right, current CRISPR systems tends to accumulate in
| the liver. Most CRISPR companies have shifted their focus to
| the liver over time because it's easiest to deliver there. Most
| viruses people use to target other organs are not large enough
| to carry CRISPR and lipid nanoparticles with CRISPR seem to
| like ending up in the liver and are hard to deliver at dose to
| hit other organ systems. It has been one of the big struggles
| of CRISPR companies. That being said, this is a huge deal and
| very encouraging.
|
| As to the FDA stance, it tends to be more willing to go ahead
| with compassionate uses like this when it's clearly life or
| death.[1]
|
| [1] https://www.statnews.com/2025/05/15/crispr-gene-editing-
| land... This discuss a little of the FDA stuff but not much
| more detail, it sounds like they did let them skip some
| testing.
| morkalork wrote:
| I think it was here a few years ago that I read a comment saying
| that sick children will be the Trojan horse for normalizing gene
| editing of humans, because who could say no to sick children,
| right? Well, guess it's here now, so how long utill the eugenics
| wars start?
| ninetyninenine wrote:
| [flagged]
| psychoslave wrote:
| [flagged]
| NoMoreNicksLeft wrote:
| [flagged]
| ninetyninenine wrote:
| A baby Hitler gaurantees a future with a grown up Hitler.
| Killing the baby eliminates that future.
|
| There could be other babies that can also grow up to be
| future Hitlers. So let's say 4 such babies exist. By
| killing one I eliminated 1/4 for futures with Grown up
| Hitlers that exist.
|
| This whole thread is getting flagged. Likely by an
| irrational parent who can't even compute natural selection,
| babe, and Hitler all in a single paragraph.
| mckn1ght wrote:
| I think part of the problem is that "really good" and "really
| bad" are not universally accepted norms for any given ethical
| question. What you're seeing is your own value system
| assumptions being checked.
|
| It's perfectly reasonable to say that while a technology has
| the propensity to be used for evil, it also has positive
| applications and that the real benefit now outweighs the
| potential downside in a hypothetical future.
|
| Otherwise you will go down a rabbit hole at the bottom of
| which lies a future where we all just kinda dig in the dirt
| with our hands until we die because every technological
| innovation can be used in a variety of ways.
|
| Like, it's silly to me that I can't bring a 1.5" blade
| keychain utility knife on a flight, and then they hand me a
| metal butter knife in first class. I could do way more damage
| with that. But they allow the butter knife because the
| utility has shown to far outweigh the potential downside that
| hasn't manifested.
|
| > I will slaughter a baby if I know for a fact that baby will
| grow up to be the next Hitler
|
| This is one of those things that is easy to say precisely due
| to the impossibility of it ever actually becoming a real
| decision you have to make.
| ninetyninenine wrote:
| >This is one of those things that is easy to say precisely
| due to the impossibility of it ever actually becoming a
| real decision you have to make.
|
| It's true. But things like this should be easy to say
| right? Like we may not be able to act logically. But we
| should be able to think logically, communicate logically
| and show that we are aware of what is logical.
|
| My post got flagged meaning a lot of people can't separate
| the two things. So for example I may not be able to kill
| the baby in reality, but I can at least see how irrational
| I am.
|
| The person who flagged me likely not only can't kill the
| baby. He has to construct an artificial reality to justify
| why he can't kill the baby and why his decision must be
| rational.
| mckn1ght wrote:
| I think things like that should be easy to say, if by
| that you mean censorship. Sure. But talk is cheap. And
| there are gradations of reality.
|
| It would maybe be easier for a 15-25 y.o. to kill a baby
| they don't know and whose parents/family they don't know,
| and maybe even easier if they don't speak their language
| or look like them. Of course, the baby wouldn't be the
| only one you'd have to kill, most likely.
|
| I submit that it would be _very very_ different if you
| found out that your 4 year old child was going to go on
| to be the next Hitler. For a "normal" person, I think
| they would go to the ends of the earth to try to shape
| them into the kind of person that wouldn't do it. I think
| very few people would coldly calculate "welp, guess I
| gotta execute this adorable little child I've grown so
| attached to" as it looks up at them saying "I love you so
| much forever, mommy/daddy" with their little doe eyes.
|
| (ETA: it also brings up side questions about nature vs
| nurture and free will)
|
| And then consider the lifelong repercussions of the
| emotional fallout. You can use all the logic in the world
| to justify the action, but your human brain will still
| torment you over it. And likely, most of the other human
| brains that learn about it would torment you as well.
|
| ---
|
| So, while I think you _can_ say things like that, ie the
| ability and allowance, I think you should question
| whether you _should_. I think saying those kinds of
| things really doesn 't add much to the discussion because
| I believe it's really just an uninformed platitude that
| only someone with a lack of life experience would
| believe.
|
| For me this all highlights the fact that meaty ethical
| questions don't have a simple reductive answer. Which
| ties back in to the original problem that OP outright
| states that this is simply and clearly the wrong path to
| go down.
|
| (PS the downvoting/flagging could be due to breaking the
| guidelines around discussing downvotes and flags, and not
| actually due to the topical content of the posts, and/or
| assuming bad faith on the part of other users as such:
| https://news.ycombinator.com/newsguidelines.html)
| ninetyninenine wrote:
| >So, while I think you can say things like that, ie the
| ability and allowance, I think you should question
| whether you should.
|
| You should because many choice in life are not strictly
| black and white. Saving a babies life versus introducing
| gene editing to humanity. If there was a baby where we
| knew he would grow up to slaughter millions it's
| absolutely worth talking about. In the age of AI and gene
| editing where things are influencing what it even means
| to be human, it is wise to stop and pause for a minute to
| ask the right question rather then charge forward with
| change that can't be taken back all because we wanted to
| save a baby.
| cooper_ganglia wrote:
| The anti-eugenics guy just said he would "absolutely" murder
| a baby...?
| ninetyninenine wrote:
| I would if I can foresee the future. But with eugenics you
| can't foresee the future. Self artificially selecting for
| genetic traits doesn't guarantee a good future. There's no
| gene for recreating Hitler either.
| dekhn wrote:
| it's unclear the outcome of this will be eugenics wars.
|
| Answering the real question- it's unlikely these techniques
| will see widespread "recreational" usage any time soon, as they
| come with a wide range of risks. Further, the scientific
| community has learned a lot from previous eugenics programs;
| anything that happens in the future will happen with both
| social and political regulation.
|
| It's ultimately hard to predict- many science fiction writers
| have speculated about this for some time, and social opinion
| can change quickly when people see new developments.
| NoMoreNicksLeft wrote:
| The problem won't be that there will be those who want to
| have babies with edited genomes, and those who oppose that.
|
| It will be that people just don't have children at all.
| beeflet wrote:
| I think one reason why people won't have children is the
| gene-editing and the IVF that is coming. Nothing is left to
| chance, or to god any more. Having children is now a
| clinical affair. It's spiritually void.
| morkalork wrote:
| That's part of why the trojan horse works so well, what is an
| unacceptable risk for someone healthy can easily be
| acceptable for someone with an otherwise untreatable
| condition. Then by the experience and knowledge gained, it
| becomes less risky for everyone.
| jjcob wrote:
| It's not a slippery slope. Fixing defects is rather
| straightforward, since it's usually a single gene that needs to
| be edited.
|
| If you want make your baby smarter, taller, or more handsome,
| it's not so easy because these traits involve 1000s of genes.
|
| For this reason I do not think that curying diseases will lead
| to designer babies.
| GenshoTikamura wrote:
| You're certaily unfamiliar with the term "incrementalism" and
| its workings
| tptacek wrote:
| No, you're assuming that polygenic trait control "scales"
| like a sort or even a search algorithm, when there's some
| molecular genetic evidence that it may instead scale like a
| cipher key size.
| sfink wrote:
| If you can affect germline cells, then I don't see how it's
| not a slippery slope. (I'm not arguing against doing it, just
| that it is a slope and the slope is slippery.) No designer
| babies necessary.
|
| I'll steelman "fixing defects" by sticking to serious
| hereditary diseases (and yes, only those that correspond to
| one or a few known genes). As more and more conditions become
| treatable, the population with access to resources will have
| lower healthcare costs by being less susceptible to problems.
| (Which is a good thing, note!) Insurance companies will have
| more and more proxies for differentiating that don't involve
| direct genetic information. Societally, "those people" [the
| poor and therefore untreated] cost more to support medically
| and are an increasing burden on the system. Eugenics gains a
| scientific basis. Do you want your daughter marrying someone
| genetically substandard, if you don't have the resources to
| correct any issues that might show up? Probably not, you're
| more likely to want to build a wall between you and them.
| Then throw over anyone who falls behind the bleeding edge of
| corrections.
|
| It'll be the latest form of redlining, but this time "red"
| refers literally to blood.
| mckn1ght wrote:
| I'm a fan of saying there's always a slippery slope, it's
| just a matter of the parameters.
|
| But, I think that it's misguided to apply the human problem
| of othering to a given technology. Regardless of technology
| X, humans are gonna human. So, if X helps some people, we
| should consider it on that basis. Because without X, we
| will still have an endless stream of other reasons to draw
| red lines, as you allude to. Except in addition we'll also
| still have the problem that X could've helped solve.
|
| If gene editing to cure diseases leads to a future where
| people want to shunt off the poor that are now the outsized
| burden of the healthcare system, the answer from where I
| sit is to find ways to make the gene therapies available to
| them, not to cart them off to concentration camps while
| they await extermination. This will require all the
| trappings of human coordination we've always had.
|
| Preventing X from ever coming to fruition doesn't at all
| prevent all possible futures where concentration death
| camps are a possibility. To me they are orthogonal
| concerns.
|
| Even if you can convince one culture/society not to do it,
| how do you stop others? Force? Now you have a different
| manifestation of the same problem to solve. Society needs
| to learn how to "yes, and..." more when it comes to this
| stuff. Otherwise, it's just war all the way down.
| sfink wrote:
| I mostly agree. Well:
|
| > This will require all the trappings of human
| coordination we've always had.
|
| It is also true to say that we've never had it as quickly
| as it has been needed, and neither is it done as well as
| it needs to be. We will blunder into things that are easy
| to predict in advance if we are willing to look and
| accept what we see, but we won't.
|
| I absolutely agree that this advance is a great thing and
| should be pursued further. But I also think that simply
| categorizing it as good or bad is a way to willfully
| ignore the unintended consequences. We should at least
| try to do better.
|
| > Society needs to learn how to "yes, and..." more when
| it comes to this stuff.
|
| Absolutely. I just think that requires nuance, wide open
| eyes, and acceptance of uncomfortable truths. Part of the
| nuance is not boiling it down to a yes/no question of
| "should this proceed?" (For example, how about: "How can
| we utilize these new capabilities to maximize benefit and
| minimize harm, when the only real lever we seem to have
| to work with is the profit motive? Everything else is
| getting undermined in its service.")
| beeflet wrote:
| >For this reason I do not think that curying diseases will
| lead to designer babies.
|
| Well, you're wrong. Where is the line drawn for what
| constitutes a disease? Retardation? Autism? Eventually every
| child below, say, 130 IQ will be considered disabled and
| unable to find work.
|
| Apply this to every other trait: cardiovascular health,
| strength, height, vision, etc. All forms of weakness can be
| considered a disease. The end product of eugenics is that
| mankind will be made into a docile and fragile monoculture.
|
| >If you want make your baby smarter, taller, or more
| handsome, it's not so easy because these traits involve 1000s
| of genes.
|
| And? it's obvious that the technology will eventually be
| capable of this, just not all at once. It starts with single-
| gene mutations, then it will be 10's of genes, and then
| hundreds and thousands.
|
| That is the slippery slope: there is absolutely nothing about
| your reasoning that prevents one step from leading to
| another.
| tptacek wrote:
| He wasn't saying that curing diseases wouldn't lead to
| designer babies because he objects to the idea (though he
| might). He's saying that the factors that lead to a "130
| IQ" score are, to the extent that they're causatively
| genetic at all, highly polygenic. Molecular genetics
| results aren't putting us on a track to predict polygenic
| behavioral traits (I guess except smoking?), let alone
| control them.
|
| It's helpful to evaluate claims on this thread in the
| context of the story. It's possible (though still a very
| open question) that complex behavioral traits will
| generally become predictable or maybe even controllable in
| the future. But those would require breakthroughs
| (including basic science discoveries breaking in the
| direction baby-designers want them to) _more significant_
| than the announcement on this story.
| stereolambda wrote:
| Honestly to me inequality has been always the main
| reasonable angle of attacking gene editing. But if vaccines
| are an analogy, many countries were eventually able to mass
| vaccinate for dangerous diseases. So this could be only the
| question of cost, after some period of only elite
| availability.
|
| There's no inherent metaphysical worth in being on any
| particular level of strength, height etc., so we can spread
| whatever is the most convenient. I think arguments against
| (that I see being made) ultimately devolve into some
| magical thinking and _a priori thing bad_. (I am glad to be
| shown otherwise.) In fact we are already messing with human
| fertility in possibly unsustainable ways, so maybe more
| tools are needed as a part of the way out.
|
| Of course there is political execution, corruption etc.,
| but I don't see it any different from other technological
| challenges that civilization has dealt with. I.e. we need
| better politics but the tech is not at fault. Gene editing
| is isolated interventions, so it's in that detail more
| manageable than for example mass surveillance which is
| hidden and continuous.
|
| One more esoteric argument is that we cannot socially agree
| on what traits are desirable. The 'The Twenty-first Voyage
| of Ijon Tichy' scenario. So opposite to "monoculture" in a
| way. But I don't see people expanding on that.
| ysofunny wrote:
| I think i'm fighting on those wars right now, you can also call
| them 'darwin wars' i suppose... but bear in mind i'm crazy and
| online
| protocolture wrote:
| Well a sick child has been healed so that necessarily means we
| will have a war about it?
| danielodievich wrote:
| For a nice thoughtful imagination of said future, Nancy Kress's
| Beggars in Spain https://en.wikipedia.org/wiki/Beggars_in_Spain
| suggests one possible outcome. It has both gene editing to make
| better humans and unproductive masses. A short yet powerful
| read.
| WorldPeas wrote:
| Not to argue semantics here but eugenics is arround selective
| breeding, this would allow for the opposite, even more
| breeding, especially in populations with hereditary ailments
| that would have refrained from the act in prior years. I do
| agree however that it is imperative greater common-sense
| regulations surrounding "aesthetic" or "performance"
| "modifications" (such callous words for young life) will need
| to be enacted.
| ecshafer wrote:
| As a father, the idea of being told my 1 week old baby is going
| to die would be my worst nightmare. The fact these doctors and
| scientists saved this childs life is a monument to modern medical
| science. This is absolutely insane. Hopefully the child doesnt
| need a liver transplant, but this is a great leap forward.
| javiramos wrote:
| Research funded by the NIH which our government is actively
| gutting
| jmcgough wrote:
| Yep, this effort is the culmination of 50 years of research.
| Could be the last harrah of the NIH with the amount of cuts
| we've had and the scientists who are taking jobs in other
| countries.
| declan_roberts wrote:
| Unfortunately a staggering amount of research in other
| countries is largely funded by the NIH/USA.
| thrance wrote:
| How so?
| jordanpg wrote:
| And so what?
| lenerdenator wrote:
| That means that it's not going to happen anymore.
|
| Unless those other countries step up and fund it
| themselves.
|
| They might. They might not.
| mmooss wrote:
| Indeed - does it matter who performed the research? If
| the CRISPR reasearch were performed in another country,
| would that change the outcome for the infant?
| lentil_soup wrote:
| It was indeed researched by a combination of countries
| and institutions
| biofox wrote:
| And those grant awards need to demonstrate how they benefit
| the USA. Many are (were) related to disease surveillance in
| developing countries to prevent pandemics, or
| collaborations with countries that are more advanced than
| the US in niche areas.
| lentil_soup wrote:
| What a shortsighted view.
|
| The technology used on this same article was funded by Max
| Planck (Germany), Sweden and the NIH to a french and a USA
| scientist. Should those collaborations stop?
| nopakos wrote:
| That may be partially true, but it's also important to
| understand that the US benefited a lot from that.
| Scientists from all over the world moved to work in the US,
| students looked forward to studying there and working in US
| companies, etc.
|
| That is changing. Children in my country are moving from
| learning English to French and German in order to study in
| European universities. This started after Brexit and will
| accelerate now.
| anarticle wrote:
| The reason for this is very pragmatic actually. We don't
| have enough researchers of a particular specialty in one
| country alone. When you get that specialized the air is
| very rare.
|
| By pooling our funding / effort we can create a larger body
| of collaborators to solve problems faster and better.
|
| It could be that the organizations are funding wild stuff
| that isn't salient. I'll concede that.
|
| However, in basic sciences there are so few specialists it
| is important to share resources. The funding is worse than
| ever (hello 2006!), and that trend is unlikely to reverse
| for a while.
|
| Source: I worked in bioenergetics for 10y, my collaborators
| were from Hungary, Chile, Canada, Israel, Italy, and more!
| At a major conference on mito energetics they all fit in
| one big lecture hall (100ish?)
| insane_dreamer wrote:
| Terrible take. Do all scientists who make breakthroughs
| that we might benefit from live in the US? CRISPR itself
| was a US-German collaboration.
| julienchastang wrote:
| Not to mention the long arcs of the careers of scientists and
| support staff involved in this breakthrough, who were also
| supported by federally funded research grants.
| dylan604 wrote:
| Interesting view as many people were so anti-MRNA vaccine
| because "it was created too fast" oblivious to the
| years/decades of study in that field that allowed for that
| "too fast" to happen.
|
| I guess it's still too early in this story's news cycle for
| the people with anti-views to be making noise yet. No GMOs,
| but human gene modification is okay. No cloning either. The
| boogeyman is gonna get us no matter what we do
| jordanpg wrote:
| As the father of a 5 year old boy with a genetic degenerative
| muscular disease whose lifespan will depend directly on how
| fast these technologies progress, I have difficulty responding
| in a civilized manner to the pointless, cruel, and stupid
| actions of the Administration in this regard. Rage is the word.
|
| It is breathtaking to consider how the members of the
| Administration and their children, parents, and grandparents
| have benefited from NIH-funded research in innumerable ways
| that they are shamefully unaware of, every time they visit the
| doctor or the ER.
| epistasis wrote:
| I have the same rage. But it extends equally to those who
| voted them in and donated to their campaigns, including my
| own family members.
|
| They have created a huge rift in this country and I am still
| trying to figure out if I will forgive my family members and
| what they'd have to do to set us on a path towards
| reconciliation.
|
| When there's a contract in place to conduct pediatric cancer
| research, and the government decides one day to break that
| contract, and it takes courts to rectify the situation, and
| then the government defies the courts, and the voters are
| cheering on the illegal actions of the politicians, well,
| rage is a mild word for what I feel.
| amendegree wrote:
| The complete lack of self awareness is always breathtaking.
| Demanding empathy from others while being completely
| incapable of it yourself is always a stunning thing to
| encounter.
| thrance wrote:
| Do not mistake legitimate grievances for a lack of
| empathy. It's entirely on republicans to stop being so
| racist and vile to recover the rest of the population's
| respect.
|
| See also: the paradox of intolerance.
| thuanao wrote:
| Government? Republicans. _Republicans_ are the ones fighting
| against government funded research. Let's put blame where blame
| belongs.
| 3D30497420 wrote:
| Also, several of the key doctors and researchers were not born
| in the US. I'm sure plenty of researchers are now thinking
| twice about working in or moving to the US.
|
| Edit: Still reading the article, but so far researchers working
| in the US have come from India, Russia, born to Taiwanese
| immigrants, and more.
| throw7 wrote:
| Gattaca here we come!
| GenshoTikamura wrote:
| One can not simply raise valid concerns about gene editing
| technologies in the hands of the entities that don't hesitate
| sending people en masse to kill and die and otherwise manifest
| their fascist cravings in the open, here on HN and walk away
| undownvoted
| kubb wrote:
| Science fiction pattern matching is a problem nobody talks
| about. People see something that vaguely resembles a movie
| that they saw and act like that movie is reality now.
| GenshoTikamura wrote:
| Another problem nobody talks about is the cognitive
| dissonance of living in the world today but dismissing all
| matching patterns as science fiction or conspiracy
| theories. Maybe narrow focus and short attention span are
| to blame
| kubb wrote:
| When someone tells you they know how the future plays out
| because they saw it in fiction, oh boy you better be
| skeptical.
| goda90 wrote:
| Maybe they are actually saying "we should take steps to
| avoid possible futures that we've already established
| would be bad in our works of art". You can't just hand
| wave away the idea that some technology could allow for
| greater invasion of privacy and worse social
| stratification when we still live in a world where
| invasion of privacy and social stratification actively
| occur.
| sfink wrote:
| There is a strong hunger for Gattaca.
|
| Heck, if parents could provide a trust fund for their kids in a
| way that their kids couldn't piss it away, they'd be all over
| it. (I'm sure this exists to varying degrees.)
|
| Look at what wealthy parents already do to get their kids into
| colleges or out of jail. I think it's ridiculously naive to
| think that we parents wouldn't jump at the chance to write
| generational wealth into our kids' genes.
|
| (This is not an argument that developing this capability is a
| bad thing and should be stopped.)
| Joel_Mckay wrote:
| Fertility care often already included testing for common
| genetic disorders, and parents with a history of severe disease
| would often make the hard choice to try again. Due to recent
| Theocratic political shifts, it means more families will face
| the worst possible life for their children.
|
| Gattaca was a film years ahead of its time, and raises the
| question of what happens when people try to "fix" human beings
| beyond disease prevention. A subtle, but important ethical
| difference. =3
| im3w1l wrote:
| Disease is fuzzy word, it basically means below some made up
| bar for healthiness. Take dyslexia as a simple example. That
| disease can by definition not exist in an illiterate
| population. We have raised the bar and now they are diseased
| in need for a cure.
|
| The more we things we cure the higher we will reach and the
| higher we reach the higher we will raise the bar. I don't
| think that's a bad thing, but its worth bearing in mind.
| Joel_Mckay wrote:
| Various learning challenges would fall outside a lifetime
| of suffering, and often such kids have statistically higher
| IQ. ;)
|
| I think it is more likely people will create synthetic
| diseases by experimenting on human beings with unique
| unpredictable gene expression.
|
| He Jiankui already crossed the ethical boundary in 2018...
| only to discover his best intentions were still nonsense.
| The GMO kids he helped edit will have a lifetime to figure
| out if that alteration negatively affected them, and as
| adults consider how their own children may change.
|
| People may cross the "Primum non nocere" line, but it can
| never ethically be justified =3
| goda90 wrote:
| I'd say Gattaca touches on how easy it is to edge a little
| over the line of what is a "disease". For example this scene
| touches on "prejudicial conditions" like baldness:
| https://www.youtube.com/watch?v=pCN5QG8Jtwg
| Traubenfuchs wrote:
| Are the edited genes inherited, or the original ones? Does the
| previous question have an answer that depends on the babies sex?
|
| From an evolutionary perspective it's interesting how the further
| medicine gets, the more we inherit genes unfit for life without
| medical support.
| breakyerself wrote:
| I'm sure we'll be editing these diseases out of the germ line
| at the same time in the not too distant future.
| EvanAnderson wrote:
| Speaking as a person whose friend died at 21 from
| complications related to cystic fibrosis I would like to see
| these diseases edited out of the germ line.
| Balgair wrote:
| No, it's only in the liver, from what I can tell from the
| science, not the gametes.
|
| No, it would not depend on the sex of the baby, as the
| chromosomes that you're editing aren't X or Y.
|
| Evolutionarily, the inheritance of genes is a far slower
| process than the medical advancements we make, so what I think
| we're seeing here is a chasing down of the low probability
| events. In that, most of the evolutionary pressure is coming
| from things like dirty water and bad food, but as we're solving
| those low hanging fruit, we have to go to lower probability
| events to make progress that feels equally important.
|
| Also, if I am wrong here on the answers to the questions,
| please correct me!
| dekhn wrote:
| If they could get complete delivery to the liver stem cells,
| then the change could be permanent, although this is making
| many simplifications.
|
| Organs in your body usually keep some very old cells (formed
| in the embryo) around which act as parents for all the new
| cells in an organ. Any cell can only divide a limited number
| of times, so they typically maintain a "tree structure" where
| the old cells create children and grandchildren (etc) that
| then differentiate into the organ-specific cells that do the
| actual organ work.
|
| If you modify only the differentiated cells, eventually they
| die, and are replaced by descendents of stem cells; if those
| stem cells didn't get modified, their descendents will not
| have the fix, and the treatment efficacy reduces over time.
| Traubenfuchs wrote:
| That's what I was asking: Baby females already have all the
| eggs they will ever have once they are born, right?
| Matryoshka doll style. While sperm is always (relatively)
| fresh.
| something098 wrote:
| Both eggs and sperm producing cells are created during
| formation of embrio. We could even define that these cells
| as "clones of you" that were created not much after your
| first cells were created, because your DNA, that undergoes
| changes in your organism is never given to your offsprings
| - it is DNA of your "clone" cells. Eggs are as you have
| defined - "very old cells". Most probably cells that are
| producing sperm also can be defined as "very old cells" as
| most probably sperm production does not function the same
| way as other cells, that are staying in organism and
| accumulate mutations.
|
| Stem cells from other organs has absolutelly nothing to do
| with this. Unless you are refering to procedures of
| planting stem cells from one organ to another to help
| failing organ, as stem cells are universal cells, that are
| able to produce cells for any organ.
| thrance wrote:
| Is the global gene pool actually degrading though? I only ever
| hear that in thinly veiled attempts at advocating for
| eugenicism. And it never comes substantiated by any research.
|
| Anyway, this baby proves we can fix hereditary diseases now.
| Traubenfuchs wrote:
| > eugenicism
|
| That comes in many forms:
|
| Black/dark one, nazi style, where you outright sterilise or
| even kill those with unhealthy/bad genes.
|
| And white/peaceful one, where you'd appeal to those with
| unhealthy/bad genes not to procreate and encourage those with
| healthy/good ones to do.
|
| You can't seriously tell me it's not extremely unethical for
| people with huntington's disease or cystic fibrosis to have
| children.
| something098 wrote:
| The issue here is that with this approach we have to ask
| who has to be limited next. Especially if you get older...
|
| >>>You can't seriously tell me it's not extremely unethical
| for people with huntington's disease or cystic fibrosis to
| have children. Don't flatter yourself - your genes are
| basic and ridddled with bad genes. You do not know what
| time bomb you are carying in your DNA.
|
| The solution that you are offering is quite simple -
| procreate early as possible and die not in old age and
| voila - there are no issues in more than 99.99% cases. But
| something tells me that you are already older than healthy
| monkey and do not plan to live in a tree - your bones are
| too old for that and thanks to evolution are not meant for
| that.
|
| Evolution of humans in future includes even longer lifespan
| which naturally comes with children produced at much later
| age than we do now and that comes with diseases to be dealt
| with, as that is part of evolution. We do not know much
| about mutations in DNA - they are never good or bad - they
| are combinations of something. For example - diabetes type
| 2 seems to be from genes, that allowed humans to survive
| hunger for long period of time - are those genes bad,
| because people are obese nowadays? As for mentioned
| diseases - we value other humans not by DNA, but what they
| are to us. You would sing a different song, when their
| offspring would have any of such disease and you are in
| luck and not planning to have any.
| Cthulhu_ wrote:
| Most genetic diseases only occur when two parents happen to
| have it, but they won't necessarily be aware of it; would
| it be unethical for people who are unaware of their genetic
| defects to have children?
|
| Second, according to a quick search, 10% of cases of
| Huntington's Disease are due to new mutations; I suspect
| (but I'm a HN commenter, no geneticist) this is the case
| for many other genetic conditions.
|
| So the other ethics question to ask: should people be able
| to get DNA tests for genetic conditions (voluntary)? I'd
| say yes. Should people be mandated to get DNA tests and be
| forbidden to procreate if there's something in there? No,
| that's eugenics. Should people who know they have a genetic
| condition and there's a chance their child has it too have
| children? That'd be their choice. I don't think it's fair
| for people to intentionally place a burden on health care
| systems like that, but thing is, there's very, very few
| people that have children with that as the intent.
| lawlessone wrote:
| couldn't be unless they reached reproductive cells.
| bilekas wrote:
| > But KJ's treatment -- which built on decades of federally
| funded research -- offers a new path for companies to develop
| personalized treatments without going through years of expensive
| development and testing.
|
| Really incredible story and I'd love to know the process for
| receiving this, for example FDA approval etc. It's nice to see
| such in-your-face results from Federal funding programs. Without
| being political, it's sometimes hard for regular people to
| appreciate just how much good actually comes out of Federal
| Funding. There was another thread where someone even said
| something along the lines of : "Well during war things get done
| faster" . This simply isn't true. It might be done louder but
| Federal Funding never stopped pushing things forward.
| baxtr wrote:
| Now imagine DOGE team of experts cutting this a couple of years
| ago
| bilekas wrote:
| I didn't want to bring up specifics but I'd be lying if it
| wasn't on my mind.
| shadowgovt wrote:
| It would probably be good if more of us brought up
| specifics more often.
| bilekas wrote:
| It would be nice, but you know how politics can usually
| turn into a bit of a toxic environment online. That said,
| I personally don't see the DOGE thing as anything other
| than a way to reduce the power of regulatory enforcement.
| I'm sure someone who would want that would never be
| conflicted with interests there...
| munificent wrote:
| I mean, the article is explicitly written to put it on your
| mind:
|
| "The implications of the treatment go far beyond treating
| KJ, said Dr. Peter Marks, _who was the Food and Drug
| Administration official overseeing gene-therapy regulation
| until he recently resigned over disagreements with Robert
| F. Kennedy Jr., the secretary of health and human
| services_. "
|
| "But KJ's treatment -- which built on decades of federally
| funded research"
|
| "The result "is a triumph for the American peoples'
| investment in biomedical research," Dr. Urnov said."
|
| "The researchers emphasized the role government funding
| played in the development."
|
| "The work, they said, began decades ago with federal
| funding for basic research on bacterial immune systems.
| That led eventually, with more federal support, to the
| discovery of CRISPR. Federal investment in sequencing the
| human genome made it possible to identify KJ's mutation.
| U.S. funding supported Dr. Liu's lab and its editing
| discovery. A federal program to study gene editing
| supported Dr. Musunuru's research. Going along in parallel
| was federally funded work that led to an understanding of
| KJ's disease."
|
| ""I don't think this could have happened in any country
| other than the U.S.," Dr. Urnov said."
|
| This is an article about federal funding of medical
| research with a cute baby as the human interest bit.
| 0_____0 wrote:
| Here's the thing - likely few would have noticed. We are
| structurally blind to the places in which public investment
| would have made our lives better, especially when they are
| things like scientific research that the vast majority never
| think about until it produces results.
| jjeaff wrote:
| I'm not an expert, but I have learned that FDA approval is not
| actually necessary for treatments and drugs. Your doctor has a
| lot of leeway when it comes to treatment but she of course
| experiences more risk of accusations of malpractice when
| prescribing off label drugs or unapproved treatments. insurance
| will also rarely cover treatment that is not FDA approved. the
| requirement for FDA approval generally has more to do with your
| legal ability to market the drug, treatment, or product.
| bilekas wrote:
| That's actually super interesting and kinda great to hear, I
| guess my follow up question is obvious but would insurance
| companies cover that kind of procedure in the US? I get the
| impression it wouldn't be.. but if out of pocket.. I know I'd
| absolutely do anything for my kid.
| tempaway43563 wrote:
| they were able to develop the treatment and fast track it
| through the FDA in six months, details in this write-up
|
| https://innovativegenomics.org/news/first-patient-treated-wi...
| efilife wrote:
| [flagged]
| foxglacier wrote:
| If you're being pedantic, babies usually never die - they
| transform into an adult which is the form that dies.
| blacksmith_tb wrote:
| Typically yes? But surviving infancy is the first step on the
| road to immortality (but that will require more than CRISPR...
| probably?)
| 331c8c71 wrote:
| Immortality? (rolleyes)
| bigs wrote:
| Hopefully after living a long and fulfilling life? Geez
| morepedantic wrote:
| Edgy! No one has ever considered the mortality of their
| children ever, or contemplated the difference between death
| before and after the realization of potential. Wow!
| efilife wrote:
| Genuinely don't know why this is edgy. I was trying to
| understand his logic
| cluse wrote:
| Having a child predecease you is one of the worst things
| that can happen to a person in general. This is a common
| sentiment in humans. The strange thing is that you
| mentioned you're trying to follow "logic." This is not
| logic. These are emotions.
| efilife wrote:
| I understand this. My question arose from the fact that
| it seems like he only cares about the child dying before
| him, not the child's death overall. It was
|
| > the idea of being told my 1 week old baby is going to
| die
|
| not
|
| > the idea of my child dying
| viewtransform wrote:
| "I am simply a machine. I do not experience death as
| humans do. It is just a cessation of function." - Data in
| Star Trek The Next Generation,
| philsnow wrote:
| It's less of
|
| > my baby is going to die, woe is me
|
| and more of
|
| > have I failed my baby so much as a parent that he won't
| even grow to adulthood (much less have a wonderful, happy
| life)
|
| It's not exactly a rational feeling; it's not like this
| baby was going to die through lack of parental effort or
| care or anything else that the parents have any real
| control over, so it's not like they could have done
| anything differently.
|
| Nonetheless, it can make you feel like an utter failure
| of a parent. To some people (I admit, not everybody),
| that is absolutely _crushing_.
| bloomingeek wrote:
| Not only a hurtful question, but a stupid one as well. Well
| done.
| efilife wrote:
| Care to explain why it is stupid? And what's hurtful about
| it, too? Deciding on a child, you KNOW it's going to day at
| some point
| tombert wrote:
| I don't really know what you're going on about? We're all
| going to die, we all know that that's going to happen, but
| none of us want to suffer and most of us would like to live
| relatively long lives.
|
| I am not a parent but I think if I did have a kid I would
| try everything I could to keep my child alive and minimize
| pain in my child's life.
| koala_man wrote:
| [flagged]
| sedatk wrote:
| Only 1% of the population has autism. Presenting autism as a
| considerable possibility for trollish behavior isn't much
| different than what the parent commenter did.
| efilife wrote:
| [flagged]
| sedatk wrote:
| now, confirmed.
| concordDance wrote:
| What was the question? The rampant flagging here is quite
| annoying.
| efilife wrote:
| My original comment said:
|
| > But your child will die and that's a fact. Is it only ok
| for it to die after you?
| imacomputertoo wrote:
| Is there more context to this question? I couldn't read
| the article because of the pay wall. But in isolation,
| this is a dumb question. All decent parents want their
| child to live as long as possible and be as healthy as
| possible. Is there something deeper you were trying to
| get at?
| tomhow wrote:
| Please don't comment like this, no matter how bad the comment
| you're replying to. The guidelines apply to everyone equally:
|
| https://news.ycombinator.com/newsguidelines.html
| koala_man wrote:
| My bad. I had been reading about how there's a frustration
| in the community that allistic people refuse to explain why
| such statements are wrong, and instead just repeat "you
| know what you did!" to people who genuinely don't.
|
| I tried to be the one who didn't do that, but missed the
| mark. I'd delete it if I could.
| tomhow wrote:
| We detached this comment from
| https://news.ycombinator.com/item?id=43998721 and marked it off
| topic.
|
| Please observe the guidelines, especially these ones:
|
| Be kind. Don't be snarky. Converse curiously; don't cross-
| examine. Edit out swipes.
|
| Comments should get more thoughtful and substantive, not less,
| as a topic gets more divisive.
|
| Please don't fulminate. Please don't sneer, including at the
| rest of the community.
|
| Please respond to the strongest plausible interpretation of
| what someone says, not a weaker one that's easier to criticize.
| Assume good faith.
|
| Eschew flamebait. Avoid generic tangents. Omit internet tropes.
|
| Please don't use Hacker News for political or ideological
| battle. It tramples curiosity.
|
| https://news.ycombinator.com/newsguidelines.html
| foxglacier wrote:
| I wonder if this also affects germline cells so he won't pass the
| same disease on to his children. If it does, that would be a
| complete departure from almost all medical treatments we use
| because most of them are just compensating for the effects of bad
| genes and leaving them in the gene pool to degrade the health of
| future generations.
| ufmace wrote:
| Did you mean to post the same link for both?
| codeulike wrote:
| Its not the same
| thomasjudge wrote:
| Can you imagine the emotional rollercoaster of this for the
| parents
| alexashka wrote:
| [flagged]
| silver_silver wrote:
| What an insanely callous and shallow take. I don't even know
| where to start. You're trying to claim the moral high ground by
| complaining that a privileged child didn't suffer and die? Do
| you even understand the point of reducing poverty?
| cayley_graph wrote:
| An absolutely terrible and tone-deaf way to phrase that
| thought, but the fact of the matter is that most of the world
| (you and I included, in all likelihood) will not get access
| to this sort of thing in our lifetimes. Not because modern
| medicine won't have been there yet, but because our lives
| (and those of our children) are simply seen as being worth
| significantly less than a rich person's desire to become
| richer.
|
| How many people can even afford to get multiple opinions for
| a weird lump on their back? Or go to the dentist for a
| strange toothache? How many people can afford to get
| consistent exercise and eat healthy? How many lives would be
| saved or at least massively bettered? We _already have the
| means_ to extend the life expectancy of the average person,
| and it 's not being used. Obviously this is a wonderful
| medical advance, but it's depressing to wonder who it's for.
| piloto_ciego wrote:
| So obviously we should not be excited about it? Lose me
| with that noise.
| cayley_graph wrote:
| Do point out where that was said, and I will be happy to
| correct it! It's important to have nuanced opinions and
| discussions about things.
| squigz wrote:
| > An absolutely terrible and tone-deaf way to phrase that
| thought, but the fact of the matter is that most of the
| world (you and I included, in all likelihood) will not get
| access to this sort of thing in our lifetimes. Not because
| modern medicine won't have been there yet, but because our
| lives (and those of our children) are simply seen as being
| worth significantly less than a rich person's desire to
| become richer.
|
| I'm as negative about the rich and powerful as anyone but
| this is such a cynical take - that might have been applied
| to many medical treatments in the past that have become
| relatively commonplace and easily accessible to people of
| all classes, at least in sane countries with sane
| healthcare systems.
| cayley_graph wrote:
| Indeed, my view is heavily American-centric. And the
| trends of the past-- which you're right about-- may not
| apply to the future given increasing wealth inequality,
| the cost-of-living crisis, and the climate crisis (for
| which undoubtedly the poorest of us will be forced to
| shoulder most of the burden).
|
| I'm explicitly not saying this work shouldn't be done, it
| should! But it does not exist in a vacuum, and it would
| be silly to pretend that it is not colored by vastly
| unequal access to modern healthcare. The reason I get
| excited about technology is because of the potential it
| holds for making us all happier and freer to do the
| things we like for longer. We are lost if we do not at
| least speak about the thunderclouds on the horizon for
| this philosophy of technology.
| squigz wrote:
| > We are lost if we do not at least speak about the
| thunderclouds on the horizon for this philosophy of
| technology.
|
| I think, every once in a while, it's okay to just
| celebrate without looking for the the clouds :)
| cayley_graph wrote:
| That's fair, I respect that view. :)
| casey2 wrote:
| What are you talking about? Since the 1800s people have
| been shipping vaccines to "most of the world"
|
| Everyone could afford to "eat healthy" and get exercise if
| governments and social planners put in a modicum of effort.
| Unfortunately they aren't directly incentives to do so.
|
| Framing either of these things as a wealth issue ignores
| both how wealthy even the poorest in the world are and the
| systems responsible for the problem. For everything else
| there's health insurance, yet another horribly mismanaged
| system.
| tomhow wrote:
| We detached this comment from
| https://news.ycombinator.com/item?id=43998721 and marked it off
| topic.
|
| Please observe the guidelines, especially these ones:
|
| _Be kind. Don 't be snarky. Converse curiously; don't cross-
| examine. Edit out swipes._
|
| _Comments should get more thoughtful and substantive, not
| less, as a topic gets more divisive._
|
| _Please don 't fulminate. Please don't sneer, including at the
| rest of the community._
|
| _Please respond to the strongest plausible interpretation of
| what someone says, not a weaker one that 's easier to
| criticize. Assume good faith._
|
| _Eschew flamebait. Avoid generic tangents. Omit internet
| tropes._
|
| _Please don 't use Hacker News for political or ideological
| battle. It tramples curiosity._
|
| https://news.ycombinator.com/newsguidelines.html
| alexashka wrote:
| [flagged]
| danielodievich wrote:
| When my second son was born and was just so very tiny some
| genetic test came out questionable. We were very strongly
| encouraged to go to Childrens hospital ASAP to get more tests. He
| handled it well, being just a few weeks old. The tests came with
| "he's a carrier of something obscure but nothing to worry about",
| so it's all forgotten.
|
| Three interesting thing come out of it from me. First, I was on
| Microsoft insurance which was quite gold plated at a time, a
| blessing only obvious in rear-view mirror, because Childrens was
| quite excited to continue any number of tests. Second, the
| technology of all this is absolutely amazing and I am so happy
| that it was available to me, and it has likely gotten better.
| Three, I want that tech to continue to expand and current
| destruction up there is going to hand this torch to someone else,
| which makes me sad.
| jjcm wrote:
| > I was on Microsoft insurance which was quite gold plated at a
| time
|
| One of the biggest perks of working for Microsoft for a long
| time was their health coverage. I can't tell you the number of
| times I'd be doing initial paperwork for a doctor's appointment
| and the receptionist would be like, "Oh you have THAT
| insurance, we're going to do all of the tests." I've heard they
| since cut back on it a little, but it truly was gold plated.
| burnt-resistor wrote:
| Circa 2005, Stanford FTEs had nine (9) health insurance plan
| choices. ;P
| dmurray wrote:
| Is that better or worse than having one really good one?
| burnt-resistor wrote:
| ;) Paradox of choice potentially, but allowed choosing
| something other than Kaiser Permanente (HMO with own
| facilities and doctors) such as a PPO option.
|
| What America really needs is an NHS not tied to
| employment or exploited by fraudsters delivering worse
| care for profit. Human rights shouldn't be perks of
| employment.
| bigtones wrote:
| My niece in Australia has a rare genetic disorder and when my
| wife and I had our first baby in California a few years ago we
| were concerned about that. We also had fantastic insurance and
| the hospital team there did a test where they took a blood
| sample from my wife and seperated the childs DNA from the
| mothers in the blood sample and tested it for several genetic
| disorders. That test is not available in Australia even today.
| ykl wrote:
| Incredibly that test (cell-free fetal DNA - cfDNA) is now
| standard in California, to the point where most expecting
| parents in California now learn the baby's gender super
| early. We learned our baby's gender only 10 weeks into
| pregnancy because of the cfDNA test.
| skissane wrote:
| > That test is not available in Australia even today.
|
| Pretty much every lab test is available in Australia if you
| are willing to pay for it; if they don't have a local lab
| capable of running the test, they'll send the sample overseas
|
| The real question is whether it is covered by insurance or
| not, and a lot of the time the answer is "no" - I recently
| forked out over US$500 for genetic tests on one of our kids
| (which the paediatrician recommended), although the results
| weren't particularly helpful ("rare variant of uncertain
| clinical significance")
| tuna-piano wrote:
| If someone in the year 2050 was to pick out the most important
| news article from 2025, I won't be surprised if they choose this
| one.
|
| For those who don't understand this stuff - we are now capable of
| editing some of a body's DNA in ways that predictably change
| their attributes. The baby's liver now has different (and better)
| DNA than the rest of its body.
|
| We still are struggling in most cases with how to deliver the DNA
| update instructions into the body. But given the pace of change
| in this space, I expect massive improvements with this update
| process over time.
|
| Combined with AI to better understand the genome, this is going
| to be a crazy century.
|
| Further reading on related topics:
|
| https://www.lesswrong.com/posts/JEhW3HDMKzekDShva/significan...
|
| https://www.lesswrong.com/posts/DfrSZaf3JC8vJdbZL/how-to-mak...
|
| https://www.lesswrong.com/posts/yT22RcWrxZcXyGjsA/how-to-hav...
| bglazer wrote:
| The "How to make superbabies" article demonstrates a couple of
| fundamental misunderstandings about genetics that make me think
| the authors don't know what they're talking about at a basic
| level. Zero mention of linkage disequilibrium. Zero mention of
| epistasis. Unquestioned assumptions of linear genotype-
| phenotype relationships for IQ. Seriously, the projections in
| their graphs into "danger zone" made me laugh out loud. This is
| elementary stuff that theyre missing but the entire essay is so
| shot through with hubris that I don't think they're capable of
| recognizing that.
| cayley_graph wrote:
| The EA community is generally incapable of self-awareness.
| The academic-but-totally-misinformed tone is comparable to
| reading LLM output. I've stopped trying to correct them, it's
| too much work on my part and not enough on theirs.
| Kuinox wrote:
| What does EA means here ?
| cayley_graph wrote:
| "Effective Altruism", something I find myself aligned
| with but not to the extremes taken by others.
| alexey-salmin wrote:
| Technically lesswrong is about rationalists not effective
| altruists, but you're right in a sense that it's the same
| breed.
|
| They think that the key to scientific thinking is to
| forego the moral limitations, not to study and learn. As
| soon as you're free from the shackles of tradition you
| become 100% rational and therefore 100% correct.
| stogot wrote:
| Except no one is 100% rational nor 100% correct
| cnity wrote:
| That community is basically the "r/iamverysmart" types
| bringing their baggage into adulthood. Almost everything
| I've read in that sphere is basically Dunning-Kruger to
| the nth degree.
| jaidhyani wrote:
| Approximately no one in the community thinks this. If you
| can go two days in a rationalist space without hearing
| about "Chesterton's Fence", I'll be impressed. No one
| thinks they're 100% rational nor that this is a
| reasonable aspiration. Traditions are generally regarded
| as sufficiently important that a not small amount of
| effort has gone into trying to build new ones. Not only
| is the case that no one thinks that anyone including
| themselves is 100% correct, but the community norm is to
| express credence in probabilities and convert those
| probabilities into bets when possible. People in the
| rationalist community constantly, loudly, and proudly
| disagree with each other, to the point that this can make
| it difficult to coordinate on anything. And everyone is
| obsessed with studying and learning, and constantly
| trying to come up with ways to do this more effectively.
|
| Like, I'm sure there are people who approximately match
| the description you're giving here. But I've spent a lot
| of time around flesh-and-blood rationalists and EAs, and
| they violently diverge from the account you give here.
| winterdeaf wrote:
| So much vitriol. I understand it's cool to hate on EA
| after the SBF fiasco, but this is just smearing.
|
| The key to scientific thinking is empiricism and
| rationalism. Some people in EA and lesswrong extend this
| to moral reasoning, but utilitarianism is not a pillar of
| these communities.
| xrhobo wrote:
| Empiricism and rationalism both tempered by a heavy dose
| of skepticism.
|
| On the other hand, maybe that is some kind of fallacy
| itself. I almost want to say that "scientific thinking"
| should be called something else. The main issue being the
| lack of experiment. Using the word "science" without
| experiment leads to all sorts of nonsense.
|
| A word that means "scientific thinking is much as
| possible without experiment" would at least embedded a
| dose of skepticism in the process.
|
| The Achilles heel of rationalism is the descent into
| modeling complete nonsense. I should give lesswrong
| another chance I suppose because that would sum up my
| experience so far, empirically.
|
| EA to me seems like obvious self serving nonsense. Hiding
| something in the obvious to avoid detection.
| morsecodist wrote:
| Effective Altruism is such an interesting title. Almost
| no one views their Altruism as ineffective. The
| differentiator is what makes their flavor of Altruism
| effective, but that's not in the title. It would be like
| calling the movement "real Altruism" or "good Altruism".
|
| A good name might be rational Altruism because in
| practice these people are from the rationalist movement
| and doing Altruism, or what they feel is Altruism. But
| the "rationalist" title suffers from similar problems.
| kmmlng wrote:
| I suppose in the beginning, it was about finding ways to
| measure how effective different altruistic approaches
| actually are and focusing your efforts on the most
| effective ones. Effective then essentially means how much
| impact you are achieving per dollar spent. One of the
| more convincing ways of doing this is looking at
| different charitable foundations and determining how much
| of each dollar you donate to them actually ends up being
| used to fix some problem and how much ends up being
| absorbed by the charitable foundation itself (salaries
| etc.) with nothing to show for it.
|
| They might have lost the plot somewhere along the line,
| but the effective altruism movement had some good ideas.
| morsecodist wrote:
| This is a super fair summary and has shifted my thinking
| on this a bit thanks.
| agos wrote:
| "Measurable altruism" would have been a better name
| sfink wrote:
| > One of the more convincing ways of doing this is
| looking at different charitable foundations and
| determining how much of each dollar you donate to them
| actually ends up being used to fix some problem and how
| much ends up being absorbed by the charitable foundation
| itself (salaries etc.) with nothing to show for it.
|
| Color me unconvinced. This will work for some situations.
| At this point, it's well known enough that it's a target
| that has ceased to be a good measure (Goodhart's Law).
|
| The usual way to look at this is to look at the
| percentage of donations spent on administrative costs.
| This makes two large assumptions: (1) administrative
| costs have zero benefit, and (2) non-administrative costs
| have 100% benefit. Both are wildly wrong.
|
| A simple counterexample: you're going to solve hunger. So
| you take donations, skim 0.0000001% off the top for your
| time because "I'm maximizing benefit, baby!", and use the
| rest to purchase bananas. You dump those bananas in a
| pile in the middle of a homeless encampment.
|
| There are so many problems with this, but I'll stick with
| the simplest: in 2 weeks, you have a pile of rotten
| bananas and everyone is starving again. It would have
| been better to store some of the bananas and give them
| out over time, which requires space and maybe even
| cooling to hold inventory, which cost money, and that's
| money that is not directly fixing the problem.
|
| There are so many examples of feel-good world saving that
| end up destroying communities and cultures, fostering
| dependence, promoting corruption, propping up the
| institutions that causing the problem, etc.
|
| Another analogy: you make a billion dollars and put it in
| a trust for your grandchild to inherit the full sum when
| they turn 16. Your efficiency measure is at 100%! What
| could possibly go wrong? Could someone improve the
| outcome by, you know, administering the trust for you?
|
| Smart administration can (but does not have to) increase
| effectiveness. Using this magical "how much of each
| dollar... ends up being used to fix some problem" metric
| is going to encourage ineffective charities and deceptive
| accounting.
| concordDance wrote:
| The vast majority of non-EA charity givers to not expend
| effort on trying to find the most dollar efficient
| charities (or indeed pushing for quantification at all),
| which makes their altruism ineffectual in a world with
| strong competition between charities (where the winners
| are inevitably those who spend the most on acquiring
| donations).
| mushi01 wrote:
| Do you really think all altruism is effective? Caring
| about the immediate well-being of others is not as
| effective as thinking in the long term. The altruism you
| are describing is misguided altruism, which ultimately
| hurts more than it helps, while effective altruism goes
| beyond the surface-level help in ways that don't enable
| self-destructing behaviours or that don't perpetuate the
| problem.
| morsecodist wrote:
| No I think almost all people doing altruism at least
| _think_ what they are doing is effective. I totally get
| that they EA people believe they have found the one true
| way but so does do others. Even if EA is correct it just
| makes talking about it confusing. Imagine if Darwin has
| called his theory "correct biology".
| tim333 wrote:
| >Almost no one views their Altruism as ineffective
|
| As someone who has occasionally given money to charities
| for homelessness and the like I don't really expect it to
| fix much. More the thought that counts.
| zarathustreal wrote:
| I like to call this "lazy altruism"
| JeremyNT wrote:
| Note that these people often condescendingly refer to
| themselves as "rationalists," as if they've unlocked some
| higher level of intellectual enlightenment which the rest
| of us are incapable of achieving.
|
| In reality, they're simply lay people who synthesize a
| lot of garbage they find on the Internet into overly
| verbose pseudo-intellectual blog posts filled with both
| the factual inaccuracies of their source material and new
| factual inaccuracies that they invent from whole cloth.
| static_void wrote:
| I once went into a LessWrong IRC server.
|
| I posted a question where I referred to something by the
| wrong name.
|
| Someone said I was confused / wrong, so I corrected myself
| and restated my question.
|
| For some 10 minutes they just kept dogpiling on the use of
| the wrong term.
|
| Never a bunch a stupider people have I met than LessWrong
| people.
| Workaccount2 wrote:
| Reminds me why I learned long ago to never post your code
| online when looking for help.
|
| 50 replies arguing about how you can simplify your for()
| loop syntax and not one reply with an actual answer.
| AlexeyBelov wrote:
| It's like Mensa: if you really want to be a part of Mensa
| and _be known for that_ , are you really that smart?
| concordDance wrote:
| Do you have some further reading where one can understand the
| basics of the subject?
| tuna-piano wrote:
| Thanks for the healthy skepticism.
|
| I still think there's a lot to learn from those articles for
| most folks uninvolved in this area, even if some of their
| immediate optimism has additional complications.
|
| I think what I mostly took away is a combination of
| technologies is likely to dramatically change how we have
| babies in the future.
|
| 1. We'll make sperm/egg from skin cells. This has already
| been done in mice[1], so it is not science fiction to do it
| in people.
|
| 2. When we're able to do this inexpensively, we could create
| virtually unlimited embryos. We can then select the embryos
| that have the most optimal traits. Initially, this may be
| simple things like not choosing embryos with certain genes
| that give higher risk of certain diseases.
|
| This may involve selecting traits like intelligence and
| height (there are already companies that offer this embryo
| selection capability [2]).
|
| 3. Instead of creating a lot of embryos and selecting the
| best ones, we could instead create just one embryo and edit
| the DNA of that embryo, which has already been done in humans
| [3]. Alternatively, we could edit the DNA of the sperm/egg
| prior to creating the embryo.
|
| The fact that none of this is science fiction is just wild.
| All of these steps have already been done in animals or
| people. Buckle up, the future is going to be wild.
|
| [1] https://www.npr.org/sections/health-
| shots/2023/05/27/1177191...
|
| [2] https://www.theguardian.com/science/2024/oct/18/us-
| startup-c...
|
| [3] https://www.science.org/content/article/chinese-
| scientist-wh...
| andreygrehov wrote:
| Are there any age restrictions?
| fendy3002 wrote:
| the usual next questions will be:
|
| - how further can we push this to make the best, most optimized
| human?
|
| - what are moral implication of this?
|
| - what are the side effects / downsides?
| Panzer04 wrote:
| Can it be applied to adults? Useless for this particular
| disorder, but what about others?
| kjkjadksj wrote:
| Low hanging fruit is very low hanging in this case. There are
| many point mutations for example that confer risk to disease
| and cancer. Lynch syndrome which confers significant risk for
| colorectal cancer for example is something that could he
| cured with transgenic humans today even with todays
| technology. Just a matter of screening gametes for the
| mutation (usually one base in the case of Lynch in
| heterozygous state with wild type healthy allele and that
| wild type healthy allele gets a second hit mutation as the
| cancer develops and things just go off the rails from there)
| and editing that base back to wildtype. No downside only
| upside with that.
|
| What gets harder are polygenic traits that even today we
| don't have great data on what are the causal alleles. But
| that is also not a technological limitation either but a
| statistical one from insufficient sampling of these polygenic
| phenotypes.
| flakeoil wrote:
| I also wonder what happens if this kid one day has kids. In
| this case it was a very rare genetic disease, but if the same
| was applied to a less rare genetic disease (where it is also
| more beneficial to have a treatment as more people have use
| of it) wouldn't the end result be that more and more kids
| will be born with these diseases?
| eimrine wrote:
| I hope we can not just heal a disease for one phenotype,
| but cure it for the whole breed.
| xvilka wrote:
| There's no "most optimized human". We are already that,
| perfected in millions of years. What could really happen is
| the split between multiple sub-species. For example, it makes
| perfect sense to do the optimization for orbital station
| dwellers or Mars colonists or underwater dwellers.
| mr_toad wrote:
| We're not perfect, we're just good enough to have survived.
|
| There are lots of hereditary illnesses and conditions that
| could probably be tweaked with DNA editing, if we can
| identify the responsible genes. If someone can cure male
| pattern baldness they'll be rich.
| rob74 wrote:
| That's all very cool, but there are also articles like this
| one: https://www.theguardian.com/us-news/2025/feb/20/trump-nih-
| cu... - I'm not able to read the Times article because it's
| paywalled, but as other commenters have mentioned, this
| research was funded by the NIH, which the Trump administration
| is currently in the process of defunding. So, if further
| progress along this road will be made, it'll probably be much
| slower and less likely to be in the US.
| cnity wrote:
| Or, it means that funding will be secured in the private
| sector. Basically by investors that focus on revenue streams
| (read: extremely expensive private healthcare).
| rob74 wrote:
| Yeah, maybe for stuff like this which (now) has direct
| applications, yes. But for basic research (and it took
| decades of basic research on genetics, gene editing etc.
| etc. to get to this point)? No way...
| top_sigrid wrote:
| https://archive.ph/VNYzA
| RandallBrown wrote:
| Is all the DNA in the liver different, or just a percentage of
| the cells?
| kjkjadksj wrote:
| Easiest way to do this stuff is before fertilization when you
| have one egg and one sperm to work with. Delivering change
| through a multicellular organism is very challenging. All this
| stuff like transgenic mice are set up in mutant crosses before
| this stage, before mating really.
|
| Eventually this will be the outcome of our species to edit the
| gametes themselves. The issue to overcome for this again won't
| be technological as that is pretty much solved but getting
| people over their own "ick" factor.
| something098 wrote:
| >>>Easiest way to do this stuff is before fertilization when
| you have one egg and one sperm to work with. Yes. But it
| seems, that nature so far is still better than we at picking
| better quality cells in laboratory environment. Not all eggs
| and sperms are equal - the difference in DNA quality varies.
|
| >>>Eventually this will be the outcome of our species to edit
| the gametes themselves. The issue to overcome for this again
| won't be technological as that is pretty much solved but
| getting people over their own "ick" factor. This is a new
| fear unlocked, as this will be like another cosmetic surgery
| procedure, which from my minimal understanding does not
| affect DNA that is delivered to offsprings - that could be
| changed but require a lot more work, but like you mentioned -
| it is easier to do before fertilization :). It is catch22
| situation rn.
| DoctorOetker wrote:
| >The issue to overcome for this again won't be technological
| as that is pretty much solved but getting people over their
| own "ick" factor.
|
| Probably requires getting investors over their profit
| incentive first, why treat a heritable disease for the
| offspring if you can charge them on a per person basis?
| nextaccountic wrote:
| > For those who don't understand this stuff - we are now
| capable of editing some of a body's DNA in ways that
| predictably change their attributes. The baby's liver now has
| different (and better) DNA than the rest of its body.
|
| How to avoid having only parts of the liver with the new DNA,
| and some other parts with the old DNA? Like a chimeric liver -
| isn't this something bad?
| beeflet wrote:
| the road to hell is paved with good intentions. In our lifetimes
| we will see a brave new world controlled through eugenics.
| TechDebtDevin wrote:
| You call it eugenics, I call it biohacking ;)
| Sabinus wrote:
| Gene editing is not eugenics. Eugenics are managed human
| breeding programs. Gene editing is gene editing.
|
| In fact, gene editing completely removes the need for eugenics
| programs.
| SalmoShalazar wrote:
| The wealthy are already engaged in eugenics via IVF embryo
| selection. There are several American startups whose clientele
| are mainly rich SV types that want to optimize the genetics of
| their children.
| hooverd wrote:
| I feel bad for those kids. Imagine having an issue that
| wasn't caught and your parents now see you as defective
| goods.
| burnt-resistor wrote:
| Hmm, I thought clinical gene editing (gene therapy) was frowned
| upon because it's inherently risky and fraught with ethical
| hazards. What technically and ethically has changed since 2005
| beyond CRISPR?
| bglazer wrote:
| Germline gene editing is still considered risky and unethical.
| That is, editing cells that form eggs and sperm, thus changing
| the genome of some of the descendants of the edited person.
| This is somatic editing. These edits will not be inherited.
|
| Somatic editing is becoming more common (see Casgevy) but there
| are technical hurdles that prevent its application to many
| cases.
| zharknado wrote:
| > This is somatic editing. These edits will not be inherited.
|
| Genuine question- how do we know that? Is it just that the
| edits are very improbable to accumulate in the gonads in
| sufficient quantities to persist? We can't actually prevent
| some fraction of them from reaching other parts of the body,
| right?
| burnt-resistor wrote:
| I'd like to know that too. When a gene therapy is
| administered to a person after birth, what % of cells get
| the edit and with what approach(es)? Doesn't that also edit
| oocytes and spermatocytes too?
| pawanjswal wrote:
| Incredible to see science and love come together to rewrite a
| baby's future.
| karunamurti wrote:
| I thought the first gene edited babies were from He Jiankui
| lemonberry wrote:
| I know nothing of this area, but it seems to me this could make
| cloning easier, right?
| aussieguy1234 wrote:
| What does this mean for longevity research? Could the same
| treatment potentially be adapted to make edits that could
| lengthen lifespan of healthy people?
| adamredwoods wrote:
| Let's be specific, they don't know if he is fully cured. They
| need more time to conclude efficacy.
| Cthulhu_ wrote:
| While true, so far so good - the baby is 9 1/2 months old now,
| whereas they had a life expectancy of a week earlier without
| intervention.
| claudeomusic wrote:
| Damn what a strange time to be alive. Juxtaposing this against
| the constant nonsense coming from RFK is as jarring as it gets.
| zephyreon wrote:
| This is incredible. Probably the most exciting piece of news I've
| read in years.
| kouru225 wrote:
| Pandora's box just opened
|
| Again
| nothrowaways wrote:
| We done to Musunuru an amazing cardiologist.
| ddudas wrote:
| I am sure this article would have been mentioned in _Homo Deus_
| Brystephor wrote:
| This is incredible work. Its jaw dropping to learn that something
| like this is possible at all. Sometimes I wish I could work for a
| company whose products make a meaningful positive contribution to
| the work.
|
| Do companies like this have a need for SWEs? Are there
| opportunities for a backend SWE without any background in
| hardware or biology?
| globular-toast wrote:
| > Do companies like this have a need for SWEs? Are there
| opportunities for a backend SWE without any background in
| hardware or biology?
|
| Of course they do. Biology and medical research can't get
| enough software people. But they're not as well funded as
| advertising or spying companies, for example, so you might have
| to take a significant pay cut.
|
| I wouldn't pigeon hole yourself as a "backend engineer". Why do
| people do that? Software is software. The bit that matters is
| the core model and algorithms etc. Whether it's exposed as a
| web server, a CLI or just a library is a peripheral detail.
|
| It's totally possible for a decent software engineer to learn
| just enough biology to get by. The limiting factor might be
| your interest, though. But if you have that then go for it. Get
| a book on genomics right now.
| rubidium wrote:
| Yes. Aldevron and IDT are two companies (owned by danaher) that
| collaborated to make this happen. They have multiple authors
| listed in the NEJM article.
|
| https://jobs.danaher.com/global/en/search-results?keywords=S...
| waiquoo wrote:
| Mark Behlke's group at IDT is the force behind a LOT of the
| development of CRISPR, but they are relatively unknown
| armedgorilla wrote:
| I run a small software team at a small biotech working on
| diseases with small patient populations, and the answer is yes
| x 1000. The issue is that in drug companies, software isn't the
| product, so SWEs will never make as much money nor be as much
| of a priority as in tech-proper.
|
| There are two categories of software we need help with:
|
| 1. Salesforce for science. We don't have big data in terms of
| volume; we have big data in terms of heterogeneity. Tons of
| small data sets that need context to be interpreted, including
| measuring uncertainty. This software, often called an eLN or
| LIMS, is offered by expensive vendors who each have their
| custom, locked-in implementations. Every organization needs
| customization on top of this that can be developed and change
| with the changing direction of the bench scientists.
|
| 2. Informatics tools. Much of the heavier computational tools
| (bioinformatics, molecular dynamics, stats) were developed by
| academic labs, who don't have the training or incentives to
| create sustainable software. Alternatively, they are made by
| vendors who write software on short-term contracts, so they
| don't have expertise in house. Our mass spec vendor told us to
| put their analysis servers on our Citrix so employees could
| access it. Citrix! If you can convince those vendor to hire you
| and rewrite their software, please do.
|
| Despite cool tools like alphafold making headlines, the
| software needs in drug development are more mundane. We need
| people who are excited to sit down with bench scientists and
| help them figure out how very normal tools can be applied to
| their work.
| carabiner wrote:
| Could this be used to heal adults with the same genetic disorder?
| palisade wrote:
| Does this mean when they grow up, their own offspring will also
| have this defect and require a correction? And, if so, does this
| mean it is now introducing this defective gene into our gene
| pool?
|
| I know this is an issue with caesarean section. It is becoming
| more prevalent because those who require it are surviving, making
| it more likely to happen in their offspring.
| mondaygreens wrote:
| How can they pass it on when they don't have the defect any
| more?
| raldi wrote:
| The DNA was only edited in the liver. But by the time this
| baby grows up and starts a family, we'll probably be able to
| fix that, too.
| aucisson_masque wrote:
| That's a bold claim. The baby is 9 month old, there are
| many things that can still go wrong with this experimental
| treatment.
|
| Hopefully not, but even then no one can say what progress
| will make science in the next 25 years.
|
| Back in the 50's people thought we would be driving in
| flying car in 2000.
| raldi wrote:
| Four years ago highly-upvoted /r/SanFrancisco comments
| said self-driving taxis were decades away: https://old.re
| ddit.com/r/sanfrancisco/comments/nbjsij/real_r...
| aucisson_masque wrote:
| 12 upvotes...
|
| You can't compare that to gene-editing treatments, that's
| two completely different level.
|
| Self driving car were always almost feasible, 20 years
| ago top gear made cars you could drive with controller
| like kids do with toy cars. We already had camera and
| computer, it was just a matter of raw CPU performance and
| software development..
| bdangubic wrote:
| we have all the CPU performance we need and all software
| development we need and self-driving cars are driving
| around in roughly 0.00785% of world's cities :)
| nahsra wrote:
| Gene editing is still pretty crude in terms of delivery.
|
| Just because you can hit some germ-line cells in the liver,
| for example, doesn't imply you'll have good penetration into
| the reproductive organs.
|
| We can't zap people and change all their DNA at once, unless
| we can intervene at the point it's just a few cells.
| poilcn wrote:
| It only affects some cells, not the whole body.
| pishpash wrote:
| If by "they" you mean their gametes, those were not edited.
| Only a component of their corporal shell was modified.
| foreigner wrote:
| We get half of our genes from each of our parents. So unless
| this person has the extremely unlikely misfortune of partnering
| with someone else with the same rare mutation, their offspring
| would only have a 50/50 chance of inheriting their copy of this
| gene. There are also medical procedures (PGD) to bring that
| chance to virtually 0%.
| Sammi wrote:
| Also parents who are both carriers have a 25% chance of
| making a sick child, a 25% chance of making a non carrier and
| non sick child, and a 25%+25% chance of making non sick yet
| carrier child. So they already have a 50% chance of making
| children who'll survive and yet be carriers of the disease. I
| guess this will increase this to 75%. But you have to
| evaluate this in connection with the rapid increases in
| genetic treatment options, which decreases the issues.
| something098 wrote:
| We don't get 50/50 of distinct genes from our parents - it is
| more like 30/70 and can be even 10/90. The whole DNA ratio in
| this equation is irrelevant, as we all have 99% of the same
| DNA. Also, in real world, one parent will consistently give
| more of their distinct genes than other parent and most
| likely that consistent gene part will have that single
| mutation that they would hope to avoid, but contain best
| genes that the parent can offer. Children from multiple
| partners could be a solution as it is a different math...
|
| >>>There are also medical procedures (PGD) to bring that
| chance to virtually 0%. For that one gene only. DNA is a math
| of sum of genes and from what I have read humans are not
| better than nature(which is not perfect, but very basic) at
| selecting best specimens of eggs and sperm, but yes -
| whatever they have picked - PGD might be able to root out
| that one single mutation, and introduce variety of other
| mutations or miss good genes from other combinations. So, it
| all depends...
| rkangel wrote:
| > know this is an issue with caesarean section. It is becoming
| more prevalent because those who require it are surviving
|
| You state this as a fact and I've heard it as a strong
| hypothesis, but I wasn't aware of much evidence to confirm it?
| palisade wrote:
| "The cesarean delivery rate increased from 5% in 1970 to
| 31.9% in 2016. This sharp increase can be attributed to
| various factors, including changes in maternal age, medical
| advancements allowing more complicated pregnancies to
| proceed, and evolving obstetric practices. In 2022, the
| United States recorded more than 3.66 million births, most of
| which resulted from spontaneous or induced labor. Labor
| dystocia remains the most common indication for primary
| cesarean delivery. Globally, cesarean delivery rates continue
| to rise, and reducing unnecessary cesarean procedures remains
| a priority in the United States, where 32.2% of all births in
| 2022 were cesarean deliveries."
|
| https://www.ncbi.nlm.nih.gov/books/NBK546707/
|
| "If this trend continues, by 2030 the highest rates are
| likely to be in Eastern Asia (63%), Latin America and the
| Caribbean (54%), Western Asia (50%), Northern Africa (48%)
| Southern Europe (47%) and Australia and New Zealand (45%),
| the research suggests."
|
| https://www.who.int/news/item/16-06-2021-caesarean-
| section-r...
|
| Note: Coincidentally, WHO's article I've linked is lamenting
| that Sub-saharan Africa only had 5% cesarean due to less
| availability of the procedure. It is their perspective that
| the increase in percentages is a good thing and indicates
| progress, instead of being concerning. And, they find Sub-
| saharan Africa's low numbers concerning, instead.
|
| Side Note: I also found lots of interesting articles which I
| haven't posted here, about epigenetic side effects caused by
| caesarean deliveries like leukemia, illnesses and other
| genetic issues. But, that seems out of scope for your
| question. You can make a quick search and find these, though.
|
| "A female-to-female familial predisposition to caesarean
| section was observed. It could be caused by biologic
| inheritance, primarily working through maternal alleles
| and/or environmental factors. The results imply that both
| mechanisms could be important."
|
| https://pubmed.ncbi.nlm.nih.gov/18540028/
|
| "Large-scale epidemiological studies indeed evidence that
| women born by C-section are more likely to deliver by
| Caesarean than women born vaginally, owing primarily to
| genetic rather than social factors."
|
| https://www.pnas.org/doi/10.1073/pnas.1712203114
| rkangel wrote:
| Interesting - thank you!
| squigz wrote:
| > Another Note: Also, ironically WHO's article I've linked
| is lamenting that Sub-saharan Africa only had 5% cesarean
| due to less availability of the procedure. It is their
| perspective that the increase in percentages is a good
| thing and indicates progress, instead of being concerning.
| And, they find Sub-saharan Africa's low numbers concerning,
| instead.
|
| Pretty sure their perspective is that "saving the lives of
| mothers and babies" indicates progress.
|
| > While a caesarean section can be an essential and
| lifesaving surgery, it can put women and babies at
| unnecessary risk of short- and long-term health problems if
| performed when there is not medical need.
|
| > Rather than recommending specific target rates, WHO
| underscores the importance of focusing on each woman's
| unique needs in pregnancy and childbirth.
|
| > WHO recommends some non-clinical actions that can reduce
| medically unnecessary use of caesarean sections, within the
| overall context of high quality and respectful care:
| palisade wrote:
| Yes, that's what they're indicating. And, it is saving
| lives. I myself was cesarean section, as was my mother. I
| wouldn't be here without it.
|
| That's the potential conundrum, if it turns out to be
| vastly increasing the need to save those lives than in
| the past due to a evolutionary pressure on the gene pool.
| If the WHO is right and we're going to start seeing 50 -
| 63% increases by 2030, what's in store for the human race
| if this rate of expansion keeps up?
|
| Will we reach a time when no one can be naturally born
| and almost our entire race has to be conceived in
| external gestation devices or cease to exist? And, when
| we reach that point will we look with concern towards
| Africa and wonder at how sad it is they're still
| conceived naturally.
|
| Edit: I don't have the answers. I'm not sure what we
| should do to course correct or if we need to. But, it is
| definitely something that should be looked into before it
| is too late, if it isn't already. And, that is why I
| brought it up in the context of this breakthrough, to ask
| if we've considered similar consequences. And, if we have
| a way to mitigate them if that turns out to be the case.
| squigz wrote:
| Are c-sections replacing 'natural' births, or are they
| simply becoming more common because we have the
| expertise? There is a difference
| palisade wrote:
| The research I've cited has indicated this is a genetic
| transfer among female-to-female births of a need for more
| cesareans.
|
| "A female-to-female familial predisposition to caesarean
| section was observed. It could be caused by biologic
| inheritance, primarily working through maternal alleles
| and/or environmental factors. The results imply that both
| mechanisms could be important."
|
| https://pubmed.ncbi.nlm.nih.gov/18540028/
|
| "Large-scale epidemiological studies indeed evidence that
| women born by C-section are more likely to deliver by
| Caesarean than women born vaginally, owing primarily to
| genetic rather than social factors."
|
| https://www.pnas.org/doi/10.1073/pnas.1712203114
| squigz wrote:
| > "Large-scale epidemiological studies indeed evidence
| that women born by C-section are more likely to deliver
| by Caesarean than women born vaginally, owing primarily
| to genetic rather than social factors."
|
| Interesting. That makes sense. I wonder if the type of
| research being pursued in TFA might be helpful.
|
| In any case, I also have to wonder whether it's
| necessarily a bad thing. I quoted 'natural' births
| earlier because... what is natural? The amount of medical
| knowledge and technology that go into births doesn't seem
| very "natural" to me, and this has advanced through the
| ages to where we are now - where we, rightfully so, look
| sadly on areas where lack of such technology and
| knowledge result in more preventable deaths of babies,
| even if their methods are more "natural"
|
| Of course, to be honest, I'm not very familiar with the
| pros and cons of c-sections vs natural births -
| particularly when the question is whether to have a
| child. I suppose that, given the choice between a
| c-section and the alternatives, most women will opt for a
| c-section, and as you point out, that means their
| daughters likely will have to as well
|
| So what might the solution even look like, apart from
| exploring the aforementioned gene-editing technology - or
| other technology - to prevent the genetic factor of
| c-sections? I would hope that "don't offer c-sections" is
| not a serious option. "Stop having kids" is one I'd
| personally suggest, but that's obviously not a sane
| global solution either.
|
| It's an interesting problem I'd be curious to hear more
| about - as I said, I'm not very familiar with this.
| squigz wrote:
| > Edit Edit: I can't reply to your comment below I think
| we've hit the leaf end of this post. But, to reply to
| your question are c-sections replacing natural births or
| are they just becoming more common? The research I've
| cited has indicated this is a genetic transfer among
| female-to-female births of a need for more cesareans.
|
| To reply after a certain number of child comments, you
| have to open the comment by clicking the timestamp thing
|
| I'm also afraid I don't understand your response. Can you
| elaborate?
| palisade wrote:
| Thanks, I replied to your other comment.
| make3 wrote:
| they could CRISPR his relevant reproductive cells, this general
| topic is an important subject of discussion
| something098 wrote:
| Ah, yes - few million of them. Simple task for sure, if the
| liver is functioning as testes.
| jodrellblank wrote:
| https://news.ycombinator.com/item?id=34925145
| something098 wrote:
| This is something I have never seen for decades - a troll
| that posts links to his own quotes...
|
| We met again.
| Tade0 wrote:
| Research is inconclusive regarding what exactly causes this
| increase.
|
| We know that infants are generally larger than 50 years ago and
| one of the factors which trigger birth is the inability of the
| mother's metabolism to support further growth of the fetus.
|
| That, combined with the fact that all over the world
| availability of nutrition is much better than half a century
| ago points to this being the culprit.
| kjkjadksj wrote:
| Honestly the biggest barriers to a lot of advancement right now
| in biology from medicine to our food supply depend squarely on
| getting uneducated people over their aversions to modern science.
| It is crazy. We are really at the "I don't trust that
| locomotive/airplane/car" stage where what the public understands
| about the field is so far away from the state of the art and the
| risk considerations that have been put in place by the actual
| domain experts who have thought of all your concerns already. It
| isn't just lay people either but government officials in charge
| or permitting and approvals that need the most convincing. They
| might be out of the field themselves for a decade or more.
| WorldPeas wrote:
| The problem is there is so little optimistic futurist media,
| the number of optimistic movies I've seen about the future I
| can count on my left hand. I can't square the blame entirely on
| Hollywood, but it's a shame there is so little discussed about
| the American state-of-the-art, something I believe China does
| better is center technological development in discourse, I see
| very little talk of the modern miracles we've witnessed outside
| of HN
| stogot wrote:
| I can't read the full article, but I'm wondering how they got FDA
| approval for a one-off personalized treatment here outside a
| trial?
|
| Aren't people dying because they were waiting for FDA approval
| for other experimental treatments?
| sirobg wrote:
| Did AI help at any step in the process?
| codeulike wrote:
| Here's the actual paper
|
| https://www.nejm.org/doi/full/10.1056/NEJMoa2504747
|
| This site has a much better write up than the NYT:
|
| https://innovativegenomics.org/news/first-patient-treated-wi...
|
| _Under normal circumstances, developing and testing a new CRISPR
| therapy takes years, but this patient -- and others born every
| day with severe genetic disorders -- do not have years to wait.
| Getting all of the pieces together for this emergency need took
| rapid coordination amongst teams at multiple academic and for-
| profit organizations, only possible because of both years of
| preparation and some lucky connections._
|
| ...
|
| _Prior to receiving the CRISPR therapy, KJ's prognosis was poor,
| but there were several factors that made KJ's case a good
| candidate for a rapid CRISPR intervention. An ongoing research
| study at the IGI called INGENUITI enabled the team to immediately
| enroll KJ and his parents for genome sequencing and analysis. The
| mutation in KJ's genome was a single base -- just a one-letter
| change in his genetic code -- and one that could be corrected
| using base editing, a gene-editing technique that only makes a
| single-letter edit. Additionally, the researchers needed to edit
| cells in the liver, where the faulty protein is made. The liver
| is currently one of the organs in the body that can be targeted
| for in vivo gene-editing therapies using lipid nanoparticles._
|
| ...
|
| _One of the first steps involved characterizing the mutation in
| KJ's genome and designing the guide RNAs that allow the base
| editor to precisely target a specific letter in the patient's
| genome for repair. Kiran Musunuru's team at Penn accomplished
| that in record time. Next, the team at the IGI jumped in to do
| the necessary safety assessment work so that the FDA could assess
| the risks._
| deadbabe wrote:
| Do you think someday soon we will have the equivalent of an LLM
| coding assistant, but for gene editing?
| Cthulhu_ wrote:
| Definitely not soon, there's a lot of conditions at the moment
| for this to be applicable (from what I gather, I'm no expert,
| just a HN commenter), and well before wholesale gene editing is
| a thing there will be the legal aspect.
|
| I mean the precursor to gene editing is selective breeding,
| which on humans quickly leads to eugenics.
| deadbabe wrote:
| Don't know why so much fear over eugenics. You either resign
| to waiting millions of years for evolution to do its thing,
| or we just take matters into our own hands at some point and
| evolve faster.
| xrhobo wrote:
| I love LLMs but that sounds like one of the worst ideas I can
| even think of.
| sas224dbm wrote:
| A Gattaca moment ?
| poopsmithe wrote:
| Thank you scientists! Next, pretty please figure out how to grow
| ironmouse a new immune system! <3
| otikik wrote:
| That is great news and my congratulations to the parents.
| Hopefully it's something that we can repeat many times in the
| future.
| voidUpdate wrote:
| Could this be used to actually change the DNA of transgender
| people?
| albrewer wrote:
| Even if it did, wouldn't the development of the wrong genitials
| for their preferred sex make an edit like this meaningless? The
| existence of XX AMAB and XY AFAB people goes to show that it's
| more about what happens in utero than what genes you have after
| birth.
| idontwantthis wrote:
| That's an entire chromosome throughout every cell in the body.
| This is a single gene change in one type of cell.
|
| No.
| zoklet-enjoyer wrote:
| My girlfriend and a couple friends work at one of the companies
| that developed this and they're quite excited and proud of it and
| I of them.
| ckemere wrote:
| The work outlined in the actual paper is quite remarkable. Within
| this 6 month period they generated transgenic mice with the
| precise mutations (paternal and maternal) this baby had in order
| to test treatment for functionality and toxicity as well as a
| doing a toxicity study in monkeys.
|
| To those thinking about commercialization opportunities, these
| two steps seem the most labor intensive and time consuming, but
| also the most necessary in order to actually have confidence to
| inject completely customized gene editing therapy in a kid.
|
| (Also worth highlighting for folks opposed to animal research.)
| jacktheturtle wrote:
| we progress closer and closer to a "red rising" type future --
| exciting and scary. exciting for the family and child <3
| thesparks wrote:
| My daughter has a genetic condition (PKU) that is also caused by
| a single letter change in her DNA and also causes brain damage if
| she consumes too much protein. Luckily it can be controlled with
| a strict low-protein diet (<10 grams a day).
|
| This is SO exciting! The fact that there is a chance of a cure
| has absolutely made my day!
| Lichtso wrote:
| Not to downplay what a huge achievement this is and how far the
| field of medicine has come, but ...
|
| this still leaves a slight bitter taste in my mouth: If they edit
| specific genes one way they can also do the opposite direction.
| And if I understand correctly, they did with a bunch of lab rats?
|
| Now, this and similar stuff have obviously been discussed before,
| essentially "12 Monkeys": Somebody releasing some runaway gene-
| editing mechanism, be it a virus or what not, and using it as
| means to mass destruction. However, that is not even what I worry
| about because that is nothing new, viruses have existed longer
| than most other kinds of life on this planet.
|
| Instead, what just popped into my mind is more like ransomware
| but on your body cells. Attacker edits victims genes to some
| condition that is lethal within a week or so and then blackmails
| them in order to edit it back. Kinda like the "Carrying the
| Antidote"-trope, only that there is no other cure in time.
|
| Maybe worth a Black Mirror episode ... anyway you heard / read it
| here first ;)
|
| edit: To the people downvoting, why not engage in the
| conversation instead? I am not saying we shouldn't be doing this,
| just that this is a fun crime scenario in a movie. What is wrong
| with that?
| skeaker wrote:
| If you wanted to do that you could just release a cancer-
| causing agent and it would similar mess with their DNA and kill
| them much more effectively at a fraction of the cost. Or just
| blow them up or something. Harming the masses in such a
| roundabout way won't leave the realm of science fiction because
| it is so much less effective and so much more difficult to do
| than existing methods. Not worth worrying about even in theory.
| treszkai wrote:
| I love how the last lines of the article read,
|
| > "I don't think this could have happened in any country other
| than the U.S.," Dr. Urnov said. > "We all said to each other,
| 'This is the most significant thing we have ever done.'"
|
| And then in the Discover More section is this article:
|
| > Lab Animals Face Being Euthanized as Trump Cuts Research
| opyate wrote:
| I prefer the Perplexity summary over the nytimes' style of
| weaving facts with narrative:
|
| https://www.perplexity.ai/page/baby-born-with-life-threateni...
___________________________________________________________________
(page generated 2025-05-17 23:01 UTC)