[HN Gopher] Baby is healed with first personalized gene-editing ...
       ___________________________________________________________________
        
       Baby is healed with first personalized gene-editing treatment
        
       Author : jbredeche
       Score  : 349 points
       Date   : 2025-05-15 18:06 UTC (4 hours ago)
        
 (HTM) web link (www.nytimes.com)
 (TXT) w3m dump (www.nytimes.com)
        
       | jakubmazanec wrote:
       | https://archive.ph/VNYzA
        
       | chewbacha wrote:
       | Good thing RFK pushed out the official overseeing this financing
       | and the current administration is actively defunding the
       | organizations that produced this.
       | 
       | Better to have more disabled or dead babies instead of science.
       | 
       | /s
        
         | JumpCrisscross wrote:
         | Genuine question: is this research not being pursued in China?
        
           | sigzero wrote:
           | Yes, other countries are pursuing this.
        
           | mylons wrote:
           | it is.
        
           | kccqzy wrote:
           | A Chinese scientist claimed that he did CRISPR on twins back
           | in 2018. https://www.science.org/content/article/crispr-
           | bombshell-chi...
           | 
           | He was jailed for illegal medical practices but it seemed
           | like he established a proper lab after serving the sentence
           | and hopefully he is focused on less objectionable practices.
           | https://www.npr.org/2023/06/08/1178695152/china-scientist-
           | he...
        
         | pacoWebConsult wrote:
         | From a purely utilitarian perspective, funding research like
         | this is not an effective use of dollars at the margin. How many
         | people could we save if an equivalent amount was put into
         | reducing obesity, smoking, and drinking? How many people could
         | we save if we stopped spending money we don't have to do things
         | that the government isn't competent at allocating anyways?
         | 
         | That's not to say the research itself is not impressive nor
         | important, but think critically about the fact that this money
         | doesn't exist in a vacuum.
        
           | rco8786 wrote:
           | Given the admin's propensity for cutting spending on research
           | like this and other domestic interests while ratcheting up
           | military spending I think that poster's point stands.
        
           | casey2 wrote:
           | Somewhere between 0 and -100,000,000
        
           | tchalla wrote:
           | I'm glad we don't only think from a utilitarian perspective
           | then.
        
             | psychoslave wrote:
             | It's not even that. Utilitarian premises still let a very
             | broad set of perspective. A long term perspective on large
             | humanity won't lead to same conclusion as what will be the
             | most joy inducing experiences in the next 24h for the 1%
             | wealthiest people in the world right now.
        
           | benlivengood wrote:
           | All those wasted dollars and time put into the discovery of
           | the germ theory of disease instead of growing and
           | distributing food to the invalids.
        
           | wat10000 wrote:
           | How do you know it's not effective? The cost per life saved
           | is extremely high _now_ , but this stuff gets better over
           | time. How much did penicillin cost to produce originally?
        
             | inglor_cz wrote:
             | Early penicilin was rare enough that they collected the
             | urine of the first patients and re-extracted penicilin from
             | it for further use.
        
             | lukevp wrote:
             | Isn't penicillin just bread mold? So probably not a great
             | example.
        
               | wat10000 wrote:
               | And yet, the first patient treated with mass-produced
               | penicillin used half the total supply, and the stuff was
               | so rare that it was extracted from patients' urine for
               | reuse.
        
           | nonameiguess wrote:
           | > How many people could we save if an equivalent amount was
           | put into reducing obesity, smoking, and drinking?
           | 
           | How confident are you the answer isn't very close to zero?
           | We've already curtailed smoking quite a bit in the past 30
           | years. At the level of an individual, it isn't any particular
           | mystery how to stop obesity or to simply not drink, but
           | population-level interventions attempting to get people to
           | voluntarily behave differently for their own health
           | historically haven't worked well in these specific domains.
           | Throwing more money at the problem doesn't seem like it would
           | obviously change that.
           | 
           | Also keep in mind that overeating and alcohol addiction have
           | significant genetic components. Research into gene editing
           | has the eventual potential to cure damn near _any_ disease,
           | including whatever pet causes you personally think are worth
           | defeating.
        
             | sigzero wrote:
             | It is also capable of creating new diseases that will be
             | resistant to anything we currently have to fight with.
        
               | inglor_cz wrote:
               | You can torture and execute people with electricity, but
               | it does not follow that discovery and use of electricity
               | was, on the net, a wash.
        
             | psychoslave wrote:
             | >population-level interventions attempting to get people to
             | voluntarily behave differently for their own health
             | historically haven't worked well in these specific domains
             | 
             | Said like that it paints things like there are not far more
             | resources spent on propagating the bad habits (as some ROI
             | is expected from this by some actors), and any attempt to
             | put a social health program in history always ended in
             | major catastrophes.
        
           | vjvjvjvjghv wrote:
           | With that line of thinking you would never do any advanced
           | science.
        
           | inglor_cz wrote:
           | This argument could be used to stop absolutely any research
           | that isn't dirt cheap.
           | 
           | Maybe even the dirt cheap one, because even 100 dollars could
           | go longer way somewhere in the Sahel.
           | 
           | It is good that the humanity does _not_ have a one-track
           | mind.
        
             | jonhohle wrote:
             | I've thought about this recently as well and I don't know
             | if I have a fully developed view. What is the moral
             | responsibility of all people to pay for medical research or
             | operations that would affect a small number of people. Is
             | it ethical to compel others to pay for the research deemed
             | valuable by some, but not by others. Who is the arbiter of
             | that research's value?
             | 
             | I could say I believe the government should fund research
             | into fixing people who think cilantro tastes like soap
             | because for most of us it is delicious and promotes healthy
             | diets. Should I be able to compel (tax) you to pay for that
             | research?
             | 
             | Where that line is drawn will always be wrong to someone.
             | How research is prioritized will always be wrong to
             | someone. Is there an ethical way to determine the best use
             | of collective resources and what portion of one's property
             | must be taken from them to fund that research.
        
           | jonplackett wrote:
           | I admit to having a similar thought to this - especially if
           | it is then going to be commercialised and sold for millions
           | of dollars per treatment.
           | 
           | BUT the long term view of creating a technology that can
           | treat any genetic illness (or maybe even any illness?) must
           | outweigh that _eventually_
        
           | rcpt wrote:
           | A huge amount of money went into researching anti obesity
           | medications
        
             | XorNot wrote:
             | Which it's worth noting, succeeded so wildly that 1/5th of
             | Denmark's jobs growth last year was related to Ozempic
             | production.
        
           | os2warpman wrote:
           | I think you may be operating under the assumption that the
           | extremely expensive price tag will need to be repeated for
           | each patient.
           | 
           | In reality, as this process becomes more mature it is going
           | to become inexpensive.
           | 
           | The reduction in cost will almost certainly be similar to
           | reduction in cost needed to sequence an individual's genome,
           | which has fallen from tens of millions to hundreds of
           | dollars.
           | 
           | The only catch is that we have to spend money to get there.
           | 
           | Another catch is that the nations who underwrite this
           | research will turn millions in investments into trillions in
           | dividends and the stingy or poor will be left in the cold.
           | 
           | Seeing that private enterprise is only good at taking
           | publicly-funded work and patenting it, and that in the
           | absence of public funding nothing ever gets invented, we
           | should be all-in on this.
           | 
           | edit: it's apropos that you mentioned obesity because GLP-1
           | drugs are the direct, irrefutable, product of spending at
           | government labs.
           | 
           | edit2: specifically, a single government scientist playing
           | around with lizard saliva in the 1970s because he thought it
           | was interesting.
        
             | WorkerBee28474 wrote:
             | > In reality, as this process becomes more mature it is
             | going to become inexpensive.
             | 
             | There's no evidence to support that gene therapy will ever
             | be inexpensive. We can merely say that the process may
             | become less shockingly expensive.
        
               | paulryanrogers wrote:
               | What should we as humanity, as society, spend most of our
               | wealth and resources doing?
               | 
               | Sending robber barrons and their girlfriends into space?
        
               | philipkglass wrote:
               | I'm of accord with the Utopians of Ada Palmer's _Too Like
               | the Lightning_ :
               | 
               |  _When a Utopian dies, of anything, the cause is marked
               | and not forgotten until solved. A fall? They rebuild the
               | site to make it safe. A criminal? They do not rest until
               | he is rendered harmless. An illness? It is researched
               | until cured, regardless of the time, the cost, over
               | generations if need be. A car crash? They create their
               | separate system, slower, less efficient, costing hours,
               | but which has never cost a single life. Even for suicide
               | they track the cause, and so, patiently, blade by blade,
               | disarm Death. Death, of course, has many weapons, and, if
               | they have deprived him of a hundred million, he still has
               | enough at hand to keep them mortal. For now._
        
               | os2warpman wrote:
               | >There's no evidence to support that gene therapy will
               | ever be inexpensive.
               | 
               | My prediction is based on the number of efforts, too
               | numerous to list here, being undertaken to develop lab
               | equipment to automate the extremely labor-intensive
               | workflow and the accumulation of vast libraries of
               | CRISPR-Cas9 screens and dependency maps, the creation of
               | which are also expensive and labor-intensive.
        
               | primax wrote:
               | > There's no evidence to support that gene therapy will
               | ever be inexpensive. We can merely say that the process
               | may become less shockingly expensive.
               | 
               | A similar thing has been said about so many cutting edge
               | therapies and technologies in the past that I think
               | you'll end up being quite surprised.
               | 
               | Eventually someone will invent a machine that spits these
               | therapies out like espresso machines.
        
           | SquirrelOnFire wrote:
           | 30 million people in the US are affected by "rare" genetic
           | conditions.
        
             | dekhn wrote:
             | Yes, but the cures here aren't general. They're highly
             | specific, and the rare conditions have a long tail- large
             | numbers of different conditions, each with a very small
             | population of affected individuals, and likely, the
             | treatments will be somewhat customized for each type of
             | disease.
        
               | pfisherman wrote:
               | See my comment above. Getting approval for rare diseases
               | and expanding the indication to the common form of the
               | disease is a well established strategy in pharma.
        
               | dekhn wrote:
               | yes, but that's totally different from coming up with a
               | generalized treatment for a wide range of "rare"
               | diseases.
        
             | pfisherman wrote:
             | Also rare genetic diseases give insight into the underlying
             | mechanisms and pathology of common sporadic diseases, which
             | can be leveraged to develop new and better therapies.
             | 
             | Getting a new drug or therapy approved for a rare form of a
             | disease and then expanding the indication to the common
             | disease patient population is a well established strategy.
        
           | delfinom wrote:
           | Because reducing obesity, smoking and drinking is not a money
           | problem in the slightest.
        
           | DoesntMatter22 wrote:
           | I completely disagree, the things you mentioned are all
           | things which a person has a level of control over.
           | 
           | This is something beyond that, and is very valuable as this
           | baby has no actual means of fighting this issue at all.
           | 
           | And who's to say this won't lead to fixing the other things
           | anyway.
           | 
           | Great use of dollars
        
           | xiphias2 wrote:
           | It's super effective funding.
           | 
           | There are known DNA changes that would probably help all
           | people with chronic diseases, but it's ethically more
           | accepted to go for the more fatal diseases and cleaner cases
           | first, like a rare mutation with a high fix rate.
        
           | psychoslave wrote:
           | That is not comparable at all. To save people from obesity,
           | smoking and drinking, you don't need more resources on
           | fundamental research. You need different education, and
           | socio-economical programs, possibly even less funds on the
           | overall: if no resources is spent anymore in promoting bad
           | habits, you end up with more financial resources and a
           | healthier population.
           | 
           | Instead if no resources is allocated on developing all the
           | technical requirements to do such a thing, humanity ends up
           | with less tools to heal itself, and that's it.
        
           | caycep wrote:
           | a) that statement above has nothing to do with RFK
           | 
           | b) the whole point of NIH and other government research funds
           | is to pay for this sort of "not clearly an effective use of
           | dollars" type of research that Pfizer et al won't touch. but
           | you can look at a ton of future applications from this -
           | lipid packaging, CRISPR methods, drug delivery, etc that had
           | to be devised, and could conceivably be commercially viable
           | if the methodology is perfected and the cost comes down.
        
         | dylan604 wrote:
         | The current administration doesn't care about kids. They only
         | want you to not terminate a new kid from being born. That they
         | care lots about. What happens after birth is not their concern.
         | Also, I think when they say they want more babies, they want a
         | specific subset of babies to increase.
        
       | colechristensen wrote:
       | >KJ has made medical history. The baby, now 9 1/2 months old,
       | became the first patient of any age to have a custom gene-editing
       | treatment, according to his doctors.
       | 
       | This is _not_ the first human to be treated with a treatment
       | under the wide umbrella of gene therapy based on their own edited
       | genes. There probably _is_ a more narrow first here but the
       | technical details get lost in journalism which is a shame.
        
         | jfarlow wrote:
         | "Custom" in that this therapy was designed AFTER a specific
         | patient showed a need, and then given to _that_ patient. In
         | most every other context a particular class of disease is
         | known, a drug designed, and then patients sought that have that
         | disease that matches the purpose of the drug.
         | 
         | What's intriguing is not the 'custom' part, but the speed part
         | (which permits it to be custom). Part of what makes CRISPR so
         | powerful is that it can easily be 'adjusted' to work on
         | different sequences based on a quick (DNA) string change - a
         | day or two. Prior custom protein engineering would take minimum
         | of months at full speed to 'adjust'.
         | 
         | That ease of manipulating DNA strings to enable rapid
         | turnaround is similar to the difference between old-school
         | protein based vaccines and the mRNA based vaccines. When you're
         | manipulating 'source code' nucleic acid sequences you can move
         | very quickly compared to manipulating the 'compiled' protein.
        
         | autoexec wrote:
         | Okay, I'll bite: Who then was the first patient of any age to
         | have a custom gene-editing treatment?
        
         | caycep wrote:
         | I want to say, maybe it's better to say first human under
         | proper IRB/regulatory compliance. Some rogue academic in China
         | tried it a few years ago, if I recall, but with absolutely no
         | oversight and he was pilloried. Also I don't think there is
         | much details about what he actually did...
         | 
         | https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
        
           | dekhn wrote:
           | What the Chinese guy (He) did was completely different. He
           | permanently altered the germline in embryos, which means that
           | every cell in the resulting baby is transformed permanently
           | with the change he made. The work he did violated a wide
           | range of good practice (specifically, the change he made
           | didn't actually work for the goal he desired, and he also
           | ignored all the ethical advice around this experiment, and
           | avoided getting the necessary approvals).
           | 
           | This research is instead a therapy used to treat an already
           | born baby, and it doesn't modify all the cells in the body.
           | Many cells in the body that are transformed by this technique
           | will eventually die and be replaced by clones of stem cells
           | which weren't transformed. I haven't read in detail about
           | whether this therapy targets stem cells, and how long term
           | effective the treatment will be- hepatocytes (liver cells)
           | turn over constantly, so I would expect if the treatment did
           | not affect the hepatocyte stem cells, it would only last
           | ~months and the treatment would have to be repeated.
        
           | zardo wrote:
           | The major difference is that was a hereditary change. So
           | those changes could now diffuse throughout the species over
           | time. As I recall it was a change that reduces vulnerability
           | to HIV infection.
        
       | MrZander wrote:
       | > To accomplish that feat, the treatment is wrapped in fatty
       | lipid molecules to protect it from degradation in the blood on
       | its way to the liver, where the edit will be made. Inside the
       | lipids are instructions that command the cells to produce an
       | enzyme that edits the gene. They also carry a molecular GPS --
       | CRISPR -- which was altered to crawl along a person's DNA until
       | it finds the exact DNA letter that needs to be changed.
       | 
       | That is one of the most incredible things I have ever read.
        
         | poyu wrote:
         | Made it sound like it's a computer, is it Turing complete?
        
           | lordnacho wrote:
           | Wouldn't it be surprising if it weren't? There's a bunch of
           | things that are Turing complete, but they are not literally a
           | molecular tape with machinery to read and write it.
        
           | caycep wrote:
           | I think I recall reading at least some papers or at least
           | exercises trying to draw analogies between Turing machines
           | and ribosome/proteonsome and other type of cellular proteins,
           | but I can't remember back to that class some 20 years ago...
        
           | fwip wrote:
           | Not really. Delivering gene edits via CRISPR in this way is
           | more like editing a text file with a single application of a
           | regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
        
             | anthk wrote:
             | So, Perl or sed. If it's Perl, the guy from XKCD was right.
             | And, maybe, Larry Wall.
        
           | koeng wrote:
           | It's fundamentally different than a computer and arguably
           | more complete.
           | 
           | The talk of "crawling along the genome" is kinda
           | fundamentally wrong though and is a bit irking - CRISPR kinda
           | just bumps around until it hits a PAM site, in which case it
           | starts checking against sgRNA. Much more random than they
           | make it seem
        
             | anthk wrote:
             | This is crazier: https://www.sciencealert.com/are-we-all-
             | quantum-computers-wi...
             | 
             | About CRISP, it's like the ultimate Perl+Regex for the
             | body.
        
           | Robotbeat wrote:
           | Yeah, in some ways, the genetic code and molecular biology
           | around transcription, etc, more closely resembles the
           | abstract Turing Machine than an actual computer does.
           | Absolutely fascinating that the messy world of biology ends
           | up being pretty analogous to the clean world of binary logic.
           | Gene sizes are expressed in kilobases, where a base carries 2
           | bits of information.
        
           | davedx wrote:
           | Sounds kind of like the infinite tape machine....
        
           | buzzy_hacker wrote:
           | Made me think of                   It was only in college,
           | when I read Douglas Hofstadter's Godel, Escher, Bach, that I
           | came to understand cells as recursively self-modifying
           | programs. The language alone was evocative. It suggested that
           | the embryo--DNA making RNA, RNA making protein, protein
           | regulating the transcription of DNA into RNA--was like a
           | small Lisp program, with macros begetting macros begetting
           | macros, the source code containing within it all of the
           | instructions required for life on Earth. Could anything more
           | interesting be imagined?              Someone should have
           | said this to me:              > Imagine a flashy spaceship
           | lands in your backyard. The door opens and you are invited to
           | investigate everything to see what you can learn. The
           | technology is clearly millions of years beyond what we can
           | make.         >         > This is biology.
           | -Bert Hubert, "Our Amazing Immune System"
           | 
           | from https://jsomers.net/i-should-have-loved-biology/
        
             | duskwuff wrote:
             | >> Imagine a flashy spaceship
             | 
             | I misread this as "fleshy" for a moment, and the quote
             | almost works better that way.
        
           | dekhn wrote:
           | This system isn't really turing complete, but existing
           | biology provides everything required to make a computer which
           | is Turing complete (assuming non-infinite tape size).
           | 
           | True programmatic biology is still very underdeveloped. I
           | have seen logic gates, memory, and state machines all
           | implemented, but I don't think anybody has built somethign
           | with a straightforward instruction set, program counter,
           | addressable RAM, and registers that was useful enough to
           | justify advanced research.
        
           | joshmarlow wrote:
           | If this thread interests you, you should check out "Blood
           | Music" by Greg Bear. It's pretty old but the premise is that
           | a researcher 'closes the loop' in a bunch of cells by making
           | them able to edit their own DNA - thus making them Turing
           | Complete.
           | 
           | Hilarity subsequently ensues.
        
             | dekhn wrote:
             | Cells are already able to edit their own DNA. Examples
             | include the yeast mating switch, in which the "active" gene
             | is replaced by one of two templates, determining the role
             | the yeast plays in mating (https://en.wikipedia.org/wiki/Ma
             | ting_of_yeast#Mechanics_of_t...)
             | 
             | Further, your immune system does some clever combinatorial
             | swapping to achieve diversity
             | (https://en.wikipedia.org/wiki/V(D)J_recombination). The
             | generated diversity is then screened by the immune system
             | to find highly effective antibodies that bind to specific
             | foreign invaders.
             | 
             | Doing something actually interesting from an engineering
             | perspective makes for fun science fiction, but as always,
             | the specific details in that story would be a very unlikely
             | outcome.
        
         | Balgair wrote:
         | One other fun part of gene editing _in vivo_ is that we don 't
         | actually use GACU (T in DNA). It turns out that if you use
         | Pseudouridine (Ps) instead of uridine (U) then the body's
         | immune system doesn't nearly alarm as much, as it doesn't
         | really see that mRNA as quite so dangerous. _But_ , the RNA ->
         | Protein equipment will just make protiens it without any
         | problems.
         | 
         | Which, yeah, that's a _miraculous_ discovery. And it was well
         | worth the 2023 Nobel in Medicine.
         | 
         | Like, the whole system for gene editing _in vivo_ that we 've
         | developed is just crazy little discovery after crazy little
         | discovery. It's all sooooo freakin' cool.
         | 
         | https://en.wikipedia.org/wiki/Pseudouridine
        
           | Teever wrote:
           | I suppose a downside (depending on your perspective) of this
           | is that it will make people who are genetically modified in
           | this fashion trivial to detect.
           | 
           | That's good if your goals are to detect genetic modification
           | which may be considered cheating in competitive sports.
           | 
           | That's bad if your goals are to detect genetically modified
           | people and discriminate against them.
           | 
           | I see a near future where the kind of people who loathe
           | things like vaccines and genuinely believe that vaccines can
           | spread illness to the non-vaccinated feel the same way about
           | other things like genetic modification and use legal
           | mechanisms to discriminate and persecute people who are
           | genetically modified.
        
             | ale42 wrote:
             | > it will make people who are genetically modified in this
             | fashion trivial to detect.
             | 
             | I'm not totally sure. If I understand it correctly, the
             | mRNA contains pseudouridine, and it makes the protein that
             | will edit the DNA. The edited DNA should look like a normal
             | one.
        
               | Teever wrote:
               | Ah. That makes sense. My mistake.
        
             | LawrenceKerr wrote:
             | If you're going to make the comparison with vaccines, and
             | if history is any indication, the more realistic worry
             | would be the other way around (since that's where the money
             | is): that genetic modifications will be mandated, and that
             | those who object will be discriminated against.
             | 
             | [And no, I am not anti-vax, nor anti-gene-editing.]
        
             | sfink wrote:
             | Careful with qualifiers there. I genuinely believe that
             | vaccines can spread illness to the non-vaccinated, since it
             | has happened many times and is well-documented. For
             | example, it's why only the inactivated (aka "dead" virus)
             | polio vaccine has been used in the US since 2000.
             | 
             | I'm not arguing about whether the risks of the attenuated
             | virus outweigh the benefits. I think the data are very
             | clear there. (Heh -- and I'm sure the vast majority of
             | people will agree with that statement, even if they
             | disagree on what the clear answer is....)
             | 
             | It's just that one shouldn't mock a belief without
             | including the necessary qualifiers, as otherwise you're
             | setting up an argument that can be invalidated by being
             | shown to be factually incorrect.
             | 
             | As for genetic modification of humans, IMO there are a lot
             | of very good reasons to be wary, most of them social. Fatal
             | hereditary conditions are obviously an easy call. What
             | about autism (not saying there's a genetic link there to
             | use, just a what if)? Or other neurodivergence? Like being
             | a troublemaker in class? Or voting for the party that
             | doesn't control the medical incentive structure? Heck,
             | let's stick with the fatal hereditary conditions, and say
             | the editing does not affect germ cells. Is it ok if the
             | human race gradually becomes dependent on gene editing to
             | produce viable offspring? Or let's say it does extend to
             | germ cells. The population with resources becomes
             | genetically superior (eg in the sense of natural lifespan
             | and lower medical costs) to those without, creating a solid
             | scientific rationale for eugenics. Think of it as redlining
             | carved into our blood.
             | 
             | I don't think discrimination against the genetically
             | modified is the only potential problem here.
             | 
             | As humans, we'll deal with these problems the way we've
             | dealt with everything else transformational. Namely: very,
             | very badly.
        
               | catigula wrote:
               | I mean, I feel like autism is a terrible example here,
               | it's not just some quirky personality trait, it's a
               | reality people live with that runs the gamut from
               | difficult to completely debilitating. Even the more mild
               | forms of autism cause extreme difficulty in many aspects
               | of life. If that was curable or preventable, that'd be
               | great.
               | 
               | If it turns out some pathogen or chemical made me
               | autistic, regardless of whether or not I could be cured
               | as an adult, I'd have certainly preferred to live the
               | reality where I had been as a child.
        
               | sfink wrote:
               | Sure, the purpose was to illustrate a slippery slope, and
               | curing autism is meant to be more obviously good than
               | abolishing all forms of neurodivergence but less
               | obviously good than fixing fatal hereditary diseases.
               | 
               | I'm not going to claim that I know the perfect place to
               | draw the line.
        
               | zmmmmm wrote:
               | I think a better reason autism is a bad example is that
               | part of its definition is that it is a consequence of
               | fundamental brain structure and development
               | (differentiating it from other psychological disorders
               | which are acquired and more malleable). These aren't
               | things you will "undo" with some gene edits. The whole
               | brain has developed in a different way. Short of re-
               | growing them a new brain you aren't going to change that
               | (assuming you wanted to).
        
             | prisenco wrote:
             | I'm less interested in detecting genetic modification for
             | the purposes of discrimination than making sure it's
             | available to everyone.
             | 
             | Assuming requisite safety of course.
        
           | alecco wrote:
           | > [...] then the body's immune system doesn't nearly alarm as
           | much, as it doesn't really see that mRNA as quite so
           | dangerous
           | 
           | Please tell me there are measures to prevent this going into
           | the wild. Please tell me this won't be used in large-scale
           | industrial farming.
        
             | imcritic wrote:
             | Farming? This will be used in warfare.
        
               | Balgair wrote:
               | Not under the current way we do things, I don't imagine.
               | 
               | So the real trick here isn't the mRNA, it's the
               | nanobubbles. Basically, you're putting these bits of mRNA
               | into these little fat bubbles and then injecting those
               | into the blood. Making those bubble shelf stable is
               | _really hard_ , hence the issues with temperature and the
               | covid vaccine. To then make those little fat bubbles
               | stable-ish in the blood is also a really hard thing to
               | do. They have to get to the right places (in this baby's
               | case, the liver) and then degrade there, drop off the
               | mRNA, and not mess up other tissues all that much. Like,
               | it's not terrible to make these micelles degrade _in
               | vivo_ , but to have them do that _and_ not degrade in the
               | tubes, ... wow... that is _really_ difficult. There 's a
               | reason that Moderna is so highly valued, and it's these
               | bubbles.
               | 
               | To try to then put these in a weapon that could do this
               | though the airways would be, like, nearly impossible.
               | Like, as in I think the second law of thermodynamics, let
               | alone biology, and then simple industrial countermeasure
               | like a N95 respirator, yeah, I think all of that makes it
               | pretty much impossible to weaponize.
               | 
               | (Hedging my bets here: I don't know if they had to do all
               | that with this baby, as you can kinda go from lab to baby
               | really fast, since it's such a special case. But for mRNA
               | based vaccines and cancer treatments, you have to deal
               | with the shelf stable issue)
               | 
               | (Also, other bio people, yes, I am trying to explain to
               | laymen here. Please chime in and tell me how I'm wrong
               | here)
        
               | okayishdefaults wrote:
               | I think it doesn't need to be a direct weapon to be used
               | in warfare. You can genetically modify your own military.
        
               | Muromec wrote:
               | That would be less effective than bio and chemical
               | weapons are. Which are not used because they just suck
        
             | Balgair wrote:
             | Yeah, it's not a drama.
             | 
             | The reason that the body doesn't alarm as much to
             | Pseudouridine, is that it's not a 'natural' RNA base.
             | Meaning that, for the most part, nature really never uses
             | it and so we haven't evolved to look out for it. Nature
             | uses Uridine and so immune systems have evolved to look out
             | for random bits of RNA in the body that use it and then
             | clean that all up.
             | 
             | It's like if you're looking to clean up legos in you house
             | with a romba that only cleans up legos. And all of a sudden
             | it finds a duplo. It's going to take a hot second to figure
             | out what to do with the duplo. And in that time, you can
             | sneak by and build a duplo fort. (Look, I know this analogy
             | is bad, but it's the best I can come up with on the fly,
             | sorry. If anyone else wnats to come up with a better one,
             | please do!).
             | 
             | The Pseudouridine is used up and degraded very quickly
             | inside the cell, minutes at the very very longest, more
             | like microseconds. It's just part of a messenger (the 'm'
             | in 'mRNA') to tell the cell to do things.
             | 
             | You might see mRNA gene editing in factory farms, but it
             | would just be easier to do germline editing instead and
             | skip spraying animals, plants, and fungi. Why waste the
             | equipment, right?
        
             | abracadaniel wrote:
             | As I understand it, there is nothing in nature that can
             | create it, so the mRNA can never be accidentally
             | replicated. It's a safety mechanism that prevents escape.
        
           | monkeycantype wrote:
           | I remember from a few few years back that the lipid coating
           | may have caused problems for the liver, when treating people
           | for diseases that needed to target a lot of tissue, such as
           | muscle disorders. Is that still the case?
        
         | shadowgovt wrote:
         | Gene therapies are pretty incredible. Some of them are still
         | making a button-hole with a machete, but that's relative to the
         | previous medical intervention of a button-hole with a tank's
         | main gun.
         | 
         | One of the treatments for sickle-cell involves switching off
         | the gene that makes the malfunctioning red blood cells, but of
         | course that's not sufficient; you'd stop making red blood cells
         | completely and you'd die. So it's combined with a modification
         | that switches _on_ a gene that all humans express pre-birth
         | that causes your body to make  "super-blood": red blood cells
         | with significantly more binding points for oxygen. This is
         | necessary because a fetus gets oxygen from its mother's blood,
         | so the increased binding affinity is useful for pulling the
         | oxygen towards the fetus at the placental interface. After
         | birth, expression of that gene is disabled and regular RBC
         | genes switch on.
         | 
         | So the therapy doesn't "fix" sickle RBCs; it disables the
         | body's ability to make them and re-enables fetal RBCs! I have
         | seen no literature on whether having fetal RBCs in adulthood
         | has any benefits or drawbacks (besides changing the affinity
         | ratio for their fetus if the patient gets pregnant, I imagine
         | increased-affinity RBC could help for athletics... But I also
         | imagine it requires more iron to generate them so has dietary
         | impact).
        
           | nomadpenguin wrote:
           | High affinity RBCs would actually be a disadvantage for
           | athletics. You actually don't need very high affinity to pick
           | up oxygen from the lungs -- your lungs are comparatively
           | extremely high in oxygen. What matters more is being able to
           | drop the oxygen off in peripheral tissues. Higher affinity
           | means that it's harder to actually deliver the oxygen, which
           | is why we evolutionarily developed the switch away from fetal
           | hemoglobin.
        
         | jjtheblunt wrote:
         | > That is one of the most incredible things I have ever read.
         | 
         | This is even more great reading behind the above:
         | 
         | https://en.wikipedia.org/wiki/Jennifer_Doudna
        
           | bengale wrote:
           | Walter Isaacson's book "The Code Breaker" is about this
           | subject. I couldn't put it down.
        
           | ascorbic wrote:
           | A rare case where the list of awards she's received is so
           | long it needs a separate Wikipedia page https://en.wikipedia.
           | org/wiki/List_of_awards_and_honors_rece...
        
             | pavlov wrote:
             | If she were a federal employee, the current administration
             | would label her a DEI hire and try to delete this page.
             | They did it to Black veterans with extraordinary
             | achievements.
        
               | blangk wrote:
               | This seems like a non sequitur.
        
         | fsndz wrote:
         | Never bet against science !
        
         | znpy wrote:
         | Yep, this is truly incredible!
        
         | ac29 wrote:
         | > To accomplish that feat, the treatment is wrapped in fatty
         | lipid molecules to protect it from degradation in the blood on
         | its way to the liver, where the edit will be made. Inside the
         | lipids are instructions that command the cells to produce an
         | enzyme that edits the gene.
         | 
         | This isnt entirely unlike the method mRNA vaccines use. Through
         | some clever biochemistry, mRNA vaccines get bits of code into
         | cells where the cell's built in code compilers manufacture
         | proteins that induce immunity.
         | 
         | We have developed software patches for our biology.
        
       | forgotpwagain wrote:
       | Detailed New England Journal of Medicine article about this case:
       | https://www.nejm.org/doi/full/10.1056/NEJMoa2504747
       | 
       | And an Editorial piece (more technical than the NYT):
       | https://www.nejm.org/doi/full/10.1056/NEJMe2505721
        
         | caycep wrote:
         | thanks for this, I think all these lay articles on biomedical
         | news should definitely be accompanied by the paper
        
           | bookofjoe wrote:
           | I always try but way more often than not the paper is
           | paywalled.
        
         | ufmace wrote:
         | Did you mean to post the same link for both?
        
       | vessenes wrote:
       | NYT isn't super specific here, but they made it sound like the
       | disease treated is liver related. My understanding is that the
       | liver is a good place to start with CRISPR-type gene treatments,
       | in that the liver normally deals with anomalous shit in your
       | bloodstream, say, like CRISPR type edits. So anywhere outside the
       | liver is going to be significantly harder to get really broad
       | uptake of gene edits.
       | 
       | It's crazy encouraging that this worked out for this kid, and I'm
       | somewhat shocked this treatment was approved in the US - I don't
       | think of us as very aggressive in areas like this. But to me,
       | really hopeful and interesting.
        
         | scotty79 wrote:
         | I don't think it's gonna be that hard. All cells that blood
         | reaches were happily taking mRNA vaccine.
        
           | derektank wrote:
           | I hate to break it to you, but it will be substantially more
           | difficult to target other organ systems. The liver is
           | uniquely easy to target with our current vectors.
           | 
           | Right off the bat, the liver receives roughly a quarter of
           | all cardiac output, either directly or second hand from the
           | digestive organs. Additionally, the liver has a fenestrated
           | endothelium which, while not completely unique in the body,
           | uniquely allows molecules like lipid nanoparticles (LNPs) to
           | access liver cells. Finally, the liver is the site of most
           | lipoprotein processing, and LNPs can be designed to take
           | advantage of the existing pathways to get the gene editing
           | mRNA into the hepatocytes. All this is to say that if you
           | have a genetic condition that primarily effects the liver,
           | there's a lot more hope for treatment in the near term than
           | for others.
           | 
           | Good lecture on the difficulties of finding appropriate
           | platforms for delivering gene therapies to cells for anyone
           | interested [1]
           | 
           | [1] https://youtu.be/6URTjoK58Yc
        
           | XorNot wrote:
           | No they were not. A vaccine triggers an immune response, not
           | a functional change.
           | 
           | mRNA vaccines are highly localized: you get a sore arm
           | because most of it only gets taken up by muscle cells around
           | the injection site, which spend some time producing the
           | antigen and triggering a primary immune response (the
           | inflammation aka the sore arm).
        
         | oceansky wrote:
         | It is caused by a missing enzyme in the liver, yes.
        
         | anarticle wrote:
         | Specifically it is this:
         | https://en.wikipedia.org/wiki/Carbamoyl_phosphate_synthetase...
         | 
         | People born with this lack the enzyme CPS1, which screws up the
         | urea cycle and causes a build up of ammonia. Ammonia build up
         | is bad for your nervous system.
        
         | cdcox wrote:
         | You are right, current CRISPR systems tends to accumulate in
         | the liver. Most CRISPR companies have shifted their focus to
         | the liver over time because it's easiest to deliver there. Most
         | viruses people use to target other organs are not large enough
         | to carry CRISPR and lipid nanoparticles with CRISPR seem to
         | like ending up in the liver and are hard to deliver at dose to
         | hit other organ systems. It has been one of the big struggles
         | of CRISPR companies. That being said, this is a huge deal and
         | very encouraging.
         | 
         | As to the FDA stance, it tends to be more willing to go ahead
         | with compassionate uses like this when it's clearly life or
         | death.[1]
         | 
         | [1] https://www.statnews.com/2025/05/15/crispr-gene-editing-
         | land... This discuss a little of the FDA stuff but not much
         | more detail, it sounds like they did let them skip some
         | testing.
        
       | morkalork wrote:
       | I think it was here a few years ago that I read a comment saying
       | that sick children will be the Trojan horse for normalizing gene
       | editing of humans, because who could say no to sick children,
       | right? Well, guess it's here now, so how long utill the eugenics
       | wars start?
        
         | ninetyninenine wrote:
         | [flagged]
        
           | psychoslave wrote:
           | [flagged]
        
             | NoMoreNicksLeft wrote:
             | [flagged]
        
             | ninetyninenine wrote:
             | A baby Hitler gaurantees a future with a grown up Hitler.
             | Killing the baby eliminates that future.
             | 
             | There could be other babies that can also grow up to be
             | future Hitlers. So let's say 4 such babies exist. By
             | killing one I eliminated 1/4 for futures with Grown up
             | Hitlers that exist.
             | 
             | This whole thread is getting flagged. Likely by an
             | irrational parent who can't even compute natural selection,
             | babe, and Hitler all in a single paragraph.
        
           | mckn1ght wrote:
           | I think part of the problem is that "really good" and "really
           | bad" are not universally accepted norms for any given ethical
           | question. What you're seeing is your own value system
           | assumptions being checked.
           | 
           | It's perfectly reasonable to say that while a technology has
           | the propensity to be used for evil, it also has positive
           | applications and that the real benefit now outweighs the
           | potential downside in a hypothetical future.
           | 
           | Otherwise you will go down a rabbit hole at the bottom of
           | which lies a future where we all just kinda dig in the dirt
           | with our hands until we die because every technological
           | innovation can be used in a variety of ways.
           | 
           | Like, it's silly to me that I can't bring a 1.5" blade
           | keychain utility knife on a flight, and then they hand me a
           | metal butter knife in first class. I could do way more damage
           | with that. But they allow the butter knife because the
           | utility has shown to far outweigh the potential downside that
           | hasn't manifested.
           | 
           | > I will slaughter a baby if I know for a fact that baby will
           | grow up to be the next Hitler
           | 
           | This is one of those things that is easy to say precisely due
           | to the impossibility of it ever actually becoming a real
           | decision you have to make.
        
             | ninetyninenine wrote:
             | >This is one of those things that is easy to say precisely
             | due to the impossibility of it ever actually becoming a
             | real decision you have to make.
             | 
             | It's true. But things like this should be easy to say
             | right? Like we may not be able to act logically. But we
             | should be able to think logically, communicate logically
             | and show that we are aware of what is logical.
             | 
             | My post got flagged meaning a lot of people can't separate
             | the two things. So for example I may not be able to kill
             | the baby in reality, but I can at least see how irrational
             | I am.
             | 
             | The person who flagged me likely not only can't kill the
             | baby. He has to construct an artificial reality to justify
             | why he can't kill the baby and why his decision must be
             | rational.
        
           | cooper_ganglia wrote:
           | The anti-eugenics guy just said he would "absolutely" murder
           | a baby...?
        
             | ninetyninenine wrote:
             | I would if I can foresee the future. But with eugenics you
             | can't foresee the future. Self artificially selecting for
             | genetic traits doesn't guarantee a good future. There's no
             | gene for recreating Hitler either.
        
         | dekhn wrote:
         | it's unclear the outcome of this will be eugenics wars.
         | 
         | Answering the real question- it's unlikely these techniques
         | will see widespread "recreational" usage any time soon, as they
         | come with a wide range of risks. Further, the scientific
         | community has learned a lot from previous eugenics programs;
         | anything that happens in the future will happen with both
         | social and political regulation.
         | 
         | It's ultimately hard to predict- many science fiction writers
         | have speculated about this for some time, and social opinion
         | can change quickly when people see new developments.
        
           | NoMoreNicksLeft wrote:
           | The problem won't be that there will be those who want to
           | have babies with edited genomes, and those who oppose that.
           | 
           | It will be that people just don't have children at all.
        
           | morkalork wrote:
           | That's part of why the trojan horse works so well, what is an
           | unacceptable risk for someone healthy can easily be
           | acceptable for someone with an otherwise untreatable
           | condition. Then by the experience and knowledge gained, it
           | becomes less risky for everyone.
        
         | jjcob wrote:
         | It's not a slippery slope. Fixing defects is rather
         | straightforward, since it's usually a single gene that needs to
         | be edited.
         | 
         | If you want make your baby smarter, taller, or more handsome,
         | it's not so easy because these traits involve 1000s of genes.
         | 
         | For this reason I do not think that curying diseases will lead
         | to designer babies.
        
           | GenshoTikamura wrote:
           | You're certaily unfamiliar with the term "incrementalism" and
           | its workings
        
           | sfink wrote:
           | If you can affect germline cells, then I don't see how it's
           | not a slippery slope. (I'm not arguing against doing it, just
           | that it is a slope and the slope is slippery.) No designer
           | babies necessary.
           | 
           | I'll steelman "fixing defects" by sticking to serious
           | hereditary diseases (and yes, only those that correspond to
           | one or a few known genes). As more and more conditions become
           | treatable, the population with access to resources will have
           | lower healthcare costs by being less susceptible to problems.
           | (Which is a good thing, note!) Insurance companies will have
           | more and more proxies for differentiating that don't involve
           | direct genetic information. Societally, "those people" [the
           | poor and therefore untreated] cost more to support medically
           | and are an increasing burden on the system. Eugenics gains a
           | scientific basis. Do you want your daughter marrying someone
           | genetically substandard, if you don't have the resources to
           | correct any issues that might show up? Probably not, you're
           | more likely to want to build a wall between you and them.
           | Then throw over anyone who falls behind the bleeding edge of
           | corrections.
           | 
           | It'll be the latest form of redlining, but this time "red"
           | refers literally to blood.
        
         | ysofunny wrote:
         | I think i'm fighting on those wars right now, you can also call
         | them 'darwin wars' i suppose... but bear in mind i'm crazy and
         | online
        
       | ecshafer wrote:
       | As a father, the idea of being told my 1 week old baby is going
       | to die would be my worst nightmare. The fact these doctors and
       | scientists saved this childs life is a monument to modern medical
       | science. This is absolutely insane. Hopefully the child doesnt
       | need a liver transplant, but this is a great leap forward.
        
         | efilife wrote:
         | But your child _will_ die and that 's a fact. Is it only ok to
         | die after you?
        
           | frankfrank13 wrote:
           | bro read the room
        
           | foxglacier wrote:
           | If you're being pedantic, babies usually never die - they
           | transform into an adult which is the form that dies.
        
           | blacksmith_tb wrote:
           | Typically yes? But surviving infancy is the first step on the
           | road to immortality (but that will require more than
           | CRISPR... probably?)
        
             | 331c8c71 wrote:
             | Immortality? (rolleyes)
        
           | bigs wrote:
           | Hopefully after living a long and fulfilling life? Geez
        
           | morepedantic wrote:
           | Edgy! No one has ever considered the mortality of their
           | children ever, or contemplated the difference between death
           | before and after the realization of potential. Wow!
        
       | javiramos wrote:
       | Research funded by the NIH which our government is actively
       | gutting
        
         | jmcgough wrote:
         | Yep, this effort is the culmination of 50 years of research.
         | Could be the last harrah of the NIH with the amount of cuts
         | we've had and the scientists who are taking jobs in other
         | countries.
        
           | declan_roberts wrote:
           | Unfortunately a staggering amount of research in other
           | countries is largely funded by the NIH/USA.
        
             | thrance wrote:
             | How so?
        
             | jordanpg wrote:
             | And so what?
        
               | lenerdenator wrote:
               | That means that it's not going to happen anymore.
               | 
               | Unless those other countries step up and fund it
               | themselves.
               | 
               | They might. They might not.
        
         | julienchastang wrote:
         | Not to mention the long arcs of the careers of scientists and
         | support staff involved in this breakthrough, who were also
         | supported by federally funded research grants.
        
           | dylan604 wrote:
           | Interesting view as many people were so anti-MRNA vaccine
           | because "it was created too fast" oblivious to the
           | years/decades of study in that field that allowed for that
           | "too fast" to happen.
           | 
           | I guess it's still too early in this story's news cycle for
           | the people with anti-views to be making noise yet. No GMOs,
           | but human gene modification is okay. No cloning either. The
           | boogeyman is gonna get us no matter what we do
        
         | thrance wrote:
         | The Secretary of Health and Human Services is a conspiracist
         | that doesn't believe in vaccines and swims in sewers with his
         | toddler to prove a point about "natural immunity" [1]. The new
         | Surgeon General prayed to the stars and the trees and took
         | mushrooms to "get ready for partnership" [2]. This is the party
         | of so-called "rationalists".
         | 
         | Fascism has a long history of rejecting rationalism and
         | science, and of embrassing esotericism [3]. Something our
         | representation of nazis in media did a terrible job at
         | conveying. We always see nazis as cold, calculating and
         | rational when they are anything but.
         | 
         | [1] https://www.nytimes.com/2025/05/12/us/politics/rfk-jr-
         | rock-c...
         | 
         | [2] https://www.pbs.org/newshour/health/trumps-new-surgeon-
         | gener...
         | 
         | [3] https://en.wikipedia.org/wiki/Occultism_in_Nazism
        
         | jordanpg wrote:
         | As the father of a 5 year old boy with a genetic degenerative
         | muscular disease whose lifespan will depend directly on how
         | fast these technologies progress, I have difficulty responding
         | in a civilized manner to the pointless, cruel, and stupid
         | actions of the Administration in this regard. Rage is the word.
         | 
         | It is breathtaking to consider how the members of the
         | Administration and their children, parents, and grandparents
         | have benefited from NIH-funded research in innumerable ways
         | that they are shamefully unaware of, every time they visit the
         | doctor or the ER.
        
           | epistasis wrote:
           | I have the same rage. But it extends equally to those who
           | voted them in and donated to their campaigns, including my
           | own family members.
           | 
           | They have created a huge rift in this country and I am still
           | trying to figure out if I will forgive my family members and
           | what they'd have to do to set us on a path towards
           | reconciliation.
           | 
           | When there's a contract in place to conduct pediatric cancer
           | research, and the government decides one day to break that
           | contract, and it takes courts to rectify the situation, and
           | then the government defies the courts, and the voters are
           | cheering on the illegal actions of the politicians, well,
           | rage is a mild word for what I feel.
        
       | throw7 wrote:
       | Gattaca here we come!
        
         | GenshoTikamura wrote:
         | One can not simply raise valid concerns about gene editing
         | technologies in the hands of the entities that don't hesitate
         | sending people en masse to kill and die and otherwise manifest
         | their fascist cravings in the open, here on HN and walk away
         | undownvoted
        
         | sfink wrote:
         | There is a strong hunger for Gattaca.
         | 
         | Heck, if parents could provide a trust fund for their kids in a
         | way that their kids couldn't piss it away, they'd be all over
         | it. (I'm sure this exists to varying degrees.)
         | 
         | Look at what wealthy parents already do to get their kids into
         | colleges or out of jail. I think it's ridiculously naive to
         | think that we parents wouldn't jump at the chance to write
         | generational wealth into our kids' genes.
         | 
         | (This is not an argument that developing this capability is a
         | bad thing and should be stopped.)
        
       | Traubenfuchs wrote:
       | Are the edited genes inherited, or the original ones? Does the
       | previous question have an answer that depends on the babies sex?
       | 
       | From an evolutionary perspective it's interesting how the further
       | medicine gets, the more we inherit genes unfit for life without
       | medical support.
        
         | breakyerself wrote:
         | I'm sure we'll be editing these diseases out of the germ line
         | at the same time in the not too distant future.
        
           | EvanAnderson wrote:
           | Speaking as a person whose friend died at 21 from
           | complications related to cystic fibrosis I would like to see
           | these diseases edited out of the germ line.
        
         | Balgair wrote:
         | No, it's only in the liver, from what I can tell from the
         | science, not the gametes.
         | 
         | No, it would not depend on the sex of the baby, as the
         | chromosomes that you're editing aren't X or Y.
         | 
         | Evolutionarily, the inheritance of genes is a far slower
         | process than the medical advancements we make, so what I think
         | we're seeing here is a chasing down of the low probability
         | events. In that, most of the evolutionary pressure is coming
         | from things like dirty water and bad food, but as we're solving
         | those low hanging fruit, we have to go to lower probability
         | events to make progress that feels equally important.
         | 
         | Also, if I am wrong here on the answers to the questions,
         | please correct me!
        
           | dekhn wrote:
           | If they could get complete delivery to the liver stem cells,
           | then the change could be permanent, although this is making
           | many simplifications.
           | 
           | Organs in your body usually keep some very old cells (formed
           | in the embryo) around which act as parents for all the new
           | cells in an organ. Any cell can only divide a limited number
           | of times, so they typically maintain a "tree structure" where
           | the old cells create children and grandchildren (etc) that
           | then differentiate into the organ-specific cells that do the
           | actual organ work.
           | 
           | If you modify only the differentiated cells, eventually they
           | die, and are replaced by descendents of stem cells; if those
           | stem cells didn't get modified, their descendents will not
           | have the fix, and the treatment efficacy reduces over time.
        
         | thrance wrote:
         | Is the global gene pool actually degrading though? I only ever
         | hear that in thinly veiled attempts at advocating for
         | eugenicism. And it never comes substantiated by any research.
         | 
         | Anyway, this baby proves we can fix hereditary diseases now.
        
         | lawlessone wrote:
         | couldn't be unless they reached reproductive cells.
        
       | bilekas wrote:
       | > But KJ's treatment -- which built on decades of federally
       | funded research -- offers a new path for companies to develop
       | personalized treatments without going through years of expensive
       | development and testing.
       | 
       | Really incredible story and I'd love to know the process for
       | receiving this, for example FDA approval etc. It's nice to see
       | such in-your-face results from Federal funding programs. Without
       | being political, it's sometimes hard for regular people to
       | appreciate just how much good actually comes out of Federal
       | Funding. There was another thread where someone even said
       | something along the lines of : "Well during war things get done
       | faster" . This simply isn't true. It might be done louder but
       | Federal Funding never stopped pushing things forward.
        
         | baxtr wrote:
         | Now imagine DOGE team of experts cutting this a couple of years
         | ago
        
           | bilekas wrote:
           | I didn't want to bring up specifics but I'd be lying if it
           | wasn't on my mind.
        
             | shadowgovt wrote:
             | It would probably be good if more of us brought up
             | specifics more often.
        
           | 0_____0 wrote:
           | Here's the thing - likely few would have noticed. We are
           | structurally blind to the places in which public investment
           | would have made our lives better, especially when they are
           | things like scientific research that the vast majority never
           | think about until it produces results.
        
         | jjeaff wrote:
         | I'm not an expert, but I have learned that FDA approval is not
         | actually necessary for treatments and drugs. Your doctor has a
         | lot of leeway when it comes to treatment but she of course
         | experiences more risk of accusations of malpractice when
         | prescribing off label drugs or unapproved treatments. insurance
         | will also rarely cover treatment that is not FDA approved. the
         | requirement for FDA approval generally has more to do with your
         | legal ability to market the drug, treatment, or product.
        
       | foxglacier wrote:
       | I wonder if this also affects germline cells so he won't pass the
       | same disease on to his children. If it does, that would be a
       | complete departure from almost all medical treatments we use
       | because most of them are just compensating for the effects of bad
       | genes and leaving them in the gene pool to degrade the health of
       | future generations.
        
       | thomasjudge wrote:
       | Can you imagine the emotional rollercoaster of this for the
       | parents
        
       ___________________________________________________________________
       (page generated 2025-05-15 23:00 UTC)