[HN Gopher] Baby is healed with first personalized gene-editing ...
___________________________________________________________________
Baby is healed with first personalized gene-editing treatment
Author : jbredeche
Score : 349 points
Date : 2025-05-15 18:06 UTC (4 hours ago)
(HTM) web link (www.nytimes.com)
(TXT) w3m dump (www.nytimes.com)
| jakubmazanec wrote:
| https://archive.ph/VNYzA
| chewbacha wrote:
| Good thing RFK pushed out the official overseeing this financing
| and the current administration is actively defunding the
| organizations that produced this.
|
| Better to have more disabled or dead babies instead of science.
|
| /s
| JumpCrisscross wrote:
| Genuine question: is this research not being pursued in China?
| sigzero wrote:
| Yes, other countries are pursuing this.
| mylons wrote:
| it is.
| kccqzy wrote:
| A Chinese scientist claimed that he did CRISPR on twins back
| in 2018. https://www.science.org/content/article/crispr-
| bombshell-chi...
|
| He was jailed for illegal medical practices but it seemed
| like he established a proper lab after serving the sentence
| and hopefully he is focused on less objectionable practices.
| https://www.npr.org/2023/06/08/1178695152/china-scientist-
| he...
| pacoWebConsult wrote:
| From a purely utilitarian perspective, funding research like
| this is not an effective use of dollars at the margin. How many
| people could we save if an equivalent amount was put into
| reducing obesity, smoking, and drinking? How many people could
| we save if we stopped spending money we don't have to do things
| that the government isn't competent at allocating anyways?
|
| That's not to say the research itself is not impressive nor
| important, but think critically about the fact that this money
| doesn't exist in a vacuum.
| rco8786 wrote:
| Given the admin's propensity for cutting spending on research
| like this and other domestic interests while ratcheting up
| military spending I think that poster's point stands.
| casey2 wrote:
| Somewhere between 0 and -100,000,000
| tchalla wrote:
| I'm glad we don't only think from a utilitarian perspective
| then.
| psychoslave wrote:
| It's not even that. Utilitarian premises still let a very
| broad set of perspective. A long term perspective on large
| humanity won't lead to same conclusion as what will be the
| most joy inducing experiences in the next 24h for the 1%
| wealthiest people in the world right now.
| benlivengood wrote:
| All those wasted dollars and time put into the discovery of
| the germ theory of disease instead of growing and
| distributing food to the invalids.
| wat10000 wrote:
| How do you know it's not effective? The cost per life saved
| is extremely high _now_ , but this stuff gets better over
| time. How much did penicillin cost to produce originally?
| inglor_cz wrote:
| Early penicilin was rare enough that they collected the
| urine of the first patients and re-extracted penicilin from
| it for further use.
| lukevp wrote:
| Isn't penicillin just bread mold? So probably not a great
| example.
| wat10000 wrote:
| And yet, the first patient treated with mass-produced
| penicillin used half the total supply, and the stuff was
| so rare that it was extracted from patients' urine for
| reuse.
| nonameiguess wrote:
| > How many people could we save if an equivalent amount was
| put into reducing obesity, smoking, and drinking?
|
| How confident are you the answer isn't very close to zero?
| We've already curtailed smoking quite a bit in the past 30
| years. At the level of an individual, it isn't any particular
| mystery how to stop obesity or to simply not drink, but
| population-level interventions attempting to get people to
| voluntarily behave differently for their own health
| historically haven't worked well in these specific domains.
| Throwing more money at the problem doesn't seem like it would
| obviously change that.
|
| Also keep in mind that overeating and alcohol addiction have
| significant genetic components. Research into gene editing
| has the eventual potential to cure damn near _any_ disease,
| including whatever pet causes you personally think are worth
| defeating.
| sigzero wrote:
| It is also capable of creating new diseases that will be
| resistant to anything we currently have to fight with.
| inglor_cz wrote:
| You can torture and execute people with electricity, but
| it does not follow that discovery and use of electricity
| was, on the net, a wash.
| psychoslave wrote:
| >population-level interventions attempting to get people to
| voluntarily behave differently for their own health
| historically haven't worked well in these specific domains
|
| Said like that it paints things like there are not far more
| resources spent on propagating the bad habits (as some ROI
| is expected from this by some actors), and any attempt to
| put a social health program in history always ended in
| major catastrophes.
| vjvjvjvjghv wrote:
| With that line of thinking you would never do any advanced
| science.
| inglor_cz wrote:
| This argument could be used to stop absolutely any research
| that isn't dirt cheap.
|
| Maybe even the dirt cheap one, because even 100 dollars could
| go longer way somewhere in the Sahel.
|
| It is good that the humanity does _not_ have a one-track
| mind.
| jonhohle wrote:
| I've thought about this recently as well and I don't know
| if I have a fully developed view. What is the moral
| responsibility of all people to pay for medical research or
| operations that would affect a small number of people. Is
| it ethical to compel others to pay for the research deemed
| valuable by some, but not by others. Who is the arbiter of
| that research's value?
|
| I could say I believe the government should fund research
| into fixing people who think cilantro tastes like soap
| because for most of us it is delicious and promotes healthy
| diets. Should I be able to compel (tax) you to pay for that
| research?
|
| Where that line is drawn will always be wrong to someone.
| How research is prioritized will always be wrong to
| someone. Is there an ethical way to determine the best use
| of collective resources and what portion of one's property
| must be taken from them to fund that research.
| jonplackett wrote:
| I admit to having a similar thought to this - especially if
| it is then going to be commercialised and sold for millions
| of dollars per treatment.
|
| BUT the long term view of creating a technology that can
| treat any genetic illness (or maybe even any illness?) must
| outweigh that _eventually_
| rcpt wrote:
| A huge amount of money went into researching anti obesity
| medications
| XorNot wrote:
| Which it's worth noting, succeeded so wildly that 1/5th of
| Denmark's jobs growth last year was related to Ozempic
| production.
| os2warpman wrote:
| I think you may be operating under the assumption that the
| extremely expensive price tag will need to be repeated for
| each patient.
|
| In reality, as this process becomes more mature it is going
| to become inexpensive.
|
| The reduction in cost will almost certainly be similar to
| reduction in cost needed to sequence an individual's genome,
| which has fallen from tens of millions to hundreds of
| dollars.
|
| The only catch is that we have to spend money to get there.
|
| Another catch is that the nations who underwrite this
| research will turn millions in investments into trillions in
| dividends and the stingy or poor will be left in the cold.
|
| Seeing that private enterprise is only good at taking
| publicly-funded work and patenting it, and that in the
| absence of public funding nothing ever gets invented, we
| should be all-in on this.
|
| edit: it's apropos that you mentioned obesity because GLP-1
| drugs are the direct, irrefutable, product of spending at
| government labs.
|
| edit2: specifically, a single government scientist playing
| around with lizard saliva in the 1970s because he thought it
| was interesting.
| WorkerBee28474 wrote:
| > In reality, as this process becomes more mature it is
| going to become inexpensive.
|
| There's no evidence to support that gene therapy will ever
| be inexpensive. We can merely say that the process may
| become less shockingly expensive.
| paulryanrogers wrote:
| What should we as humanity, as society, spend most of our
| wealth and resources doing?
|
| Sending robber barrons and their girlfriends into space?
| philipkglass wrote:
| I'm of accord with the Utopians of Ada Palmer's _Too Like
| the Lightning_ :
|
| _When a Utopian dies, of anything, the cause is marked
| and not forgotten until solved. A fall? They rebuild the
| site to make it safe. A criminal? They do not rest until
| he is rendered harmless. An illness? It is researched
| until cured, regardless of the time, the cost, over
| generations if need be. A car crash? They create their
| separate system, slower, less efficient, costing hours,
| but which has never cost a single life. Even for suicide
| they track the cause, and so, patiently, blade by blade,
| disarm Death. Death, of course, has many weapons, and, if
| they have deprived him of a hundred million, he still has
| enough at hand to keep them mortal. For now._
| os2warpman wrote:
| >There's no evidence to support that gene therapy will
| ever be inexpensive.
|
| My prediction is based on the number of efforts, too
| numerous to list here, being undertaken to develop lab
| equipment to automate the extremely labor-intensive
| workflow and the accumulation of vast libraries of
| CRISPR-Cas9 screens and dependency maps, the creation of
| which are also expensive and labor-intensive.
| primax wrote:
| > There's no evidence to support that gene therapy will
| ever be inexpensive. We can merely say that the process
| may become less shockingly expensive.
|
| A similar thing has been said about so many cutting edge
| therapies and technologies in the past that I think
| you'll end up being quite surprised.
|
| Eventually someone will invent a machine that spits these
| therapies out like espresso machines.
| SquirrelOnFire wrote:
| 30 million people in the US are affected by "rare" genetic
| conditions.
| dekhn wrote:
| Yes, but the cures here aren't general. They're highly
| specific, and the rare conditions have a long tail- large
| numbers of different conditions, each with a very small
| population of affected individuals, and likely, the
| treatments will be somewhat customized for each type of
| disease.
| pfisherman wrote:
| See my comment above. Getting approval for rare diseases
| and expanding the indication to the common form of the
| disease is a well established strategy in pharma.
| dekhn wrote:
| yes, but that's totally different from coming up with a
| generalized treatment for a wide range of "rare"
| diseases.
| pfisherman wrote:
| Also rare genetic diseases give insight into the underlying
| mechanisms and pathology of common sporadic diseases, which
| can be leveraged to develop new and better therapies.
|
| Getting a new drug or therapy approved for a rare form of a
| disease and then expanding the indication to the common
| disease patient population is a well established strategy.
| delfinom wrote:
| Because reducing obesity, smoking and drinking is not a money
| problem in the slightest.
| DoesntMatter22 wrote:
| I completely disagree, the things you mentioned are all
| things which a person has a level of control over.
|
| This is something beyond that, and is very valuable as this
| baby has no actual means of fighting this issue at all.
|
| And who's to say this won't lead to fixing the other things
| anyway.
|
| Great use of dollars
| xiphias2 wrote:
| It's super effective funding.
|
| There are known DNA changes that would probably help all
| people with chronic diseases, but it's ethically more
| accepted to go for the more fatal diseases and cleaner cases
| first, like a rare mutation with a high fix rate.
| psychoslave wrote:
| That is not comparable at all. To save people from obesity,
| smoking and drinking, you don't need more resources on
| fundamental research. You need different education, and
| socio-economical programs, possibly even less funds on the
| overall: if no resources is spent anymore in promoting bad
| habits, you end up with more financial resources and a
| healthier population.
|
| Instead if no resources is allocated on developing all the
| technical requirements to do such a thing, humanity ends up
| with less tools to heal itself, and that's it.
| caycep wrote:
| a) that statement above has nothing to do with RFK
|
| b) the whole point of NIH and other government research funds
| is to pay for this sort of "not clearly an effective use of
| dollars" type of research that Pfizer et al won't touch. but
| you can look at a ton of future applications from this -
| lipid packaging, CRISPR methods, drug delivery, etc that had
| to be devised, and could conceivably be commercially viable
| if the methodology is perfected and the cost comes down.
| dylan604 wrote:
| The current administration doesn't care about kids. They only
| want you to not terminate a new kid from being born. That they
| care lots about. What happens after birth is not their concern.
| Also, I think when they say they want more babies, they want a
| specific subset of babies to increase.
| colechristensen wrote:
| >KJ has made medical history. The baby, now 9 1/2 months old,
| became the first patient of any age to have a custom gene-editing
| treatment, according to his doctors.
|
| This is _not_ the first human to be treated with a treatment
| under the wide umbrella of gene therapy based on their own edited
| genes. There probably _is_ a more narrow first here but the
| technical details get lost in journalism which is a shame.
| jfarlow wrote:
| "Custom" in that this therapy was designed AFTER a specific
| patient showed a need, and then given to _that_ patient. In
| most every other context a particular class of disease is
| known, a drug designed, and then patients sought that have that
| disease that matches the purpose of the drug.
|
| What's intriguing is not the 'custom' part, but the speed part
| (which permits it to be custom). Part of what makes CRISPR so
| powerful is that it can easily be 'adjusted' to work on
| different sequences based on a quick (DNA) string change - a
| day or two. Prior custom protein engineering would take minimum
| of months at full speed to 'adjust'.
|
| That ease of manipulating DNA strings to enable rapid
| turnaround is similar to the difference between old-school
| protein based vaccines and the mRNA based vaccines. When you're
| manipulating 'source code' nucleic acid sequences you can move
| very quickly compared to manipulating the 'compiled' protein.
| autoexec wrote:
| Okay, I'll bite: Who then was the first patient of any age to
| have a custom gene-editing treatment?
| caycep wrote:
| I want to say, maybe it's better to say first human under
| proper IRB/regulatory compliance. Some rogue academic in China
| tried it a few years ago, if I recall, but with absolutely no
| oversight and he was pilloried. Also I don't think there is
| much details about what he actually did...
|
| https://www.npr.org/2023/06/08/1178695152/china-scientist-he...
| dekhn wrote:
| What the Chinese guy (He) did was completely different. He
| permanently altered the germline in embryos, which means that
| every cell in the resulting baby is transformed permanently
| with the change he made. The work he did violated a wide
| range of good practice (specifically, the change he made
| didn't actually work for the goal he desired, and he also
| ignored all the ethical advice around this experiment, and
| avoided getting the necessary approvals).
|
| This research is instead a therapy used to treat an already
| born baby, and it doesn't modify all the cells in the body.
| Many cells in the body that are transformed by this technique
| will eventually die and be replaced by clones of stem cells
| which weren't transformed. I haven't read in detail about
| whether this therapy targets stem cells, and how long term
| effective the treatment will be- hepatocytes (liver cells)
| turn over constantly, so I would expect if the treatment did
| not affect the hepatocyte stem cells, it would only last
| ~months and the treatment would have to be repeated.
| zardo wrote:
| The major difference is that was a hereditary change. So
| those changes could now diffuse throughout the species over
| time. As I recall it was a change that reduces vulnerability
| to HIV infection.
| MrZander wrote:
| > To accomplish that feat, the treatment is wrapped in fatty
| lipid molecules to protect it from degradation in the blood on
| its way to the liver, where the edit will be made. Inside the
| lipids are instructions that command the cells to produce an
| enzyme that edits the gene. They also carry a molecular GPS --
| CRISPR -- which was altered to crawl along a person's DNA until
| it finds the exact DNA letter that needs to be changed.
|
| That is one of the most incredible things I have ever read.
| poyu wrote:
| Made it sound like it's a computer, is it Turing complete?
| lordnacho wrote:
| Wouldn't it be surprising if it weren't? There's a bunch of
| things that are Turing complete, but they are not literally a
| molecular tape with machinery to read and write it.
| caycep wrote:
| I think I recall reading at least some papers or at least
| exercises trying to draw analogies between Turing machines
| and ribosome/proteonsome and other type of cellular proteins,
| but I can't remember back to that class some 20 years ago...
| fwip wrote:
| Not really. Delivering gene edits via CRISPR in this way is
| more like editing a text file with a single application of a
| regex - `s/ACTGACTGACTG/ACTGACTGAAAAAAAACTGACTG/g`.
| anthk wrote:
| So, Perl or sed. If it's Perl, the guy from XKCD was right.
| And, maybe, Larry Wall.
| koeng wrote:
| It's fundamentally different than a computer and arguably
| more complete.
|
| The talk of "crawling along the genome" is kinda
| fundamentally wrong though and is a bit irking - CRISPR kinda
| just bumps around until it hits a PAM site, in which case it
| starts checking against sgRNA. Much more random than they
| make it seem
| anthk wrote:
| This is crazier: https://www.sciencealert.com/are-we-all-
| quantum-computers-wi...
|
| About CRISP, it's like the ultimate Perl+Regex for the
| body.
| Robotbeat wrote:
| Yeah, in some ways, the genetic code and molecular biology
| around transcription, etc, more closely resembles the
| abstract Turing Machine than an actual computer does.
| Absolutely fascinating that the messy world of biology ends
| up being pretty analogous to the clean world of binary logic.
| Gene sizes are expressed in kilobases, where a base carries 2
| bits of information.
| davedx wrote:
| Sounds kind of like the infinite tape machine....
| buzzy_hacker wrote:
| Made me think of It was only in college,
| when I read Douglas Hofstadter's Godel, Escher, Bach, that I
| came to understand cells as recursively self-modifying
| programs. The language alone was evocative. It suggested that
| the embryo--DNA making RNA, RNA making protein, protein
| regulating the transcription of DNA into RNA--was like a
| small Lisp program, with macros begetting macros begetting
| macros, the source code containing within it all of the
| instructions required for life on Earth. Could anything more
| interesting be imagined? Someone should have
| said this to me: > Imagine a flashy spaceship
| lands in your backyard. The door opens and you are invited to
| investigate everything to see what you can learn. The
| technology is clearly millions of years beyond what we can
| make. > > This is biology.
| -Bert Hubert, "Our Amazing Immune System"
|
| from https://jsomers.net/i-should-have-loved-biology/
| duskwuff wrote:
| >> Imagine a flashy spaceship
|
| I misread this as "fleshy" for a moment, and the quote
| almost works better that way.
| dekhn wrote:
| This system isn't really turing complete, but existing
| biology provides everything required to make a computer which
| is Turing complete (assuming non-infinite tape size).
|
| True programmatic biology is still very underdeveloped. I
| have seen logic gates, memory, and state machines all
| implemented, but I don't think anybody has built somethign
| with a straightforward instruction set, program counter,
| addressable RAM, and registers that was useful enough to
| justify advanced research.
| joshmarlow wrote:
| If this thread interests you, you should check out "Blood
| Music" by Greg Bear. It's pretty old but the premise is that
| a researcher 'closes the loop' in a bunch of cells by making
| them able to edit their own DNA - thus making them Turing
| Complete.
|
| Hilarity subsequently ensues.
| dekhn wrote:
| Cells are already able to edit their own DNA. Examples
| include the yeast mating switch, in which the "active" gene
| is replaced by one of two templates, determining the role
| the yeast plays in mating (https://en.wikipedia.org/wiki/Ma
| ting_of_yeast#Mechanics_of_t...)
|
| Further, your immune system does some clever combinatorial
| swapping to achieve diversity
| (https://en.wikipedia.org/wiki/V(D)J_recombination). The
| generated diversity is then screened by the immune system
| to find highly effective antibodies that bind to specific
| foreign invaders.
|
| Doing something actually interesting from an engineering
| perspective makes for fun science fiction, but as always,
| the specific details in that story would be a very unlikely
| outcome.
| Balgair wrote:
| One other fun part of gene editing _in vivo_ is that we don 't
| actually use GACU (T in DNA). It turns out that if you use
| Pseudouridine (Ps) instead of uridine (U) then the body's
| immune system doesn't nearly alarm as much, as it doesn't
| really see that mRNA as quite so dangerous. _But_ , the RNA ->
| Protein equipment will just make protiens it without any
| problems.
|
| Which, yeah, that's a _miraculous_ discovery. And it was well
| worth the 2023 Nobel in Medicine.
|
| Like, the whole system for gene editing _in vivo_ that we 've
| developed is just crazy little discovery after crazy little
| discovery. It's all sooooo freakin' cool.
|
| https://en.wikipedia.org/wiki/Pseudouridine
| Teever wrote:
| I suppose a downside (depending on your perspective) of this
| is that it will make people who are genetically modified in
| this fashion trivial to detect.
|
| That's good if your goals are to detect genetic modification
| which may be considered cheating in competitive sports.
|
| That's bad if your goals are to detect genetically modified
| people and discriminate against them.
|
| I see a near future where the kind of people who loathe
| things like vaccines and genuinely believe that vaccines can
| spread illness to the non-vaccinated feel the same way about
| other things like genetic modification and use legal
| mechanisms to discriminate and persecute people who are
| genetically modified.
| ale42 wrote:
| > it will make people who are genetically modified in this
| fashion trivial to detect.
|
| I'm not totally sure. If I understand it correctly, the
| mRNA contains pseudouridine, and it makes the protein that
| will edit the DNA. The edited DNA should look like a normal
| one.
| Teever wrote:
| Ah. That makes sense. My mistake.
| LawrenceKerr wrote:
| If you're going to make the comparison with vaccines, and
| if history is any indication, the more realistic worry
| would be the other way around (since that's where the money
| is): that genetic modifications will be mandated, and that
| those who object will be discriminated against.
|
| [And no, I am not anti-vax, nor anti-gene-editing.]
| sfink wrote:
| Careful with qualifiers there. I genuinely believe that
| vaccines can spread illness to the non-vaccinated, since it
| has happened many times and is well-documented. For
| example, it's why only the inactivated (aka "dead" virus)
| polio vaccine has been used in the US since 2000.
|
| I'm not arguing about whether the risks of the attenuated
| virus outweigh the benefits. I think the data are very
| clear there. (Heh -- and I'm sure the vast majority of
| people will agree with that statement, even if they
| disagree on what the clear answer is....)
|
| It's just that one shouldn't mock a belief without
| including the necessary qualifiers, as otherwise you're
| setting up an argument that can be invalidated by being
| shown to be factually incorrect.
|
| As for genetic modification of humans, IMO there are a lot
| of very good reasons to be wary, most of them social. Fatal
| hereditary conditions are obviously an easy call. What
| about autism (not saying there's a genetic link there to
| use, just a what if)? Or other neurodivergence? Like being
| a troublemaker in class? Or voting for the party that
| doesn't control the medical incentive structure? Heck,
| let's stick with the fatal hereditary conditions, and say
| the editing does not affect germ cells. Is it ok if the
| human race gradually becomes dependent on gene editing to
| produce viable offspring? Or let's say it does extend to
| germ cells. The population with resources becomes
| genetically superior (eg in the sense of natural lifespan
| and lower medical costs) to those without, creating a solid
| scientific rationale for eugenics. Think of it as redlining
| carved into our blood.
|
| I don't think discrimination against the genetically
| modified is the only potential problem here.
|
| As humans, we'll deal with these problems the way we've
| dealt with everything else transformational. Namely: very,
| very badly.
| catigula wrote:
| I mean, I feel like autism is a terrible example here,
| it's not just some quirky personality trait, it's a
| reality people live with that runs the gamut from
| difficult to completely debilitating. Even the more mild
| forms of autism cause extreme difficulty in many aspects
| of life. If that was curable or preventable, that'd be
| great.
|
| If it turns out some pathogen or chemical made me
| autistic, regardless of whether or not I could be cured
| as an adult, I'd have certainly preferred to live the
| reality where I had been as a child.
| sfink wrote:
| Sure, the purpose was to illustrate a slippery slope, and
| curing autism is meant to be more obviously good than
| abolishing all forms of neurodivergence but less
| obviously good than fixing fatal hereditary diseases.
|
| I'm not going to claim that I know the perfect place to
| draw the line.
| zmmmmm wrote:
| I think a better reason autism is a bad example is that
| part of its definition is that it is a consequence of
| fundamental brain structure and development
| (differentiating it from other psychological disorders
| which are acquired and more malleable). These aren't
| things you will "undo" with some gene edits. The whole
| brain has developed in a different way. Short of re-
| growing them a new brain you aren't going to change that
| (assuming you wanted to).
| prisenco wrote:
| I'm less interested in detecting genetic modification for
| the purposes of discrimination than making sure it's
| available to everyone.
|
| Assuming requisite safety of course.
| alecco wrote:
| > [...] then the body's immune system doesn't nearly alarm as
| much, as it doesn't really see that mRNA as quite so
| dangerous
|
| Please tell me there are measures to prevent this going into
| the wild. Please tell me this won't be used in large-scale
| industrial farming.
| imcritic wrote:
| Farming? This will be used in warfare.
| Balgair wrote:
| Not under the current way we do things, I don't imagine.
|
| So the real trick here isn't the mRNA, it's the
| nanobubbles. Basically, you're putting these bits of mRNA
| into these little fat bubbles and then injecting those
| into the blood. Making those bubble shelf stable is
| _really hard_ , hence the issues with temperature and the
| covid vaccine. To then make those little fat bubbles
| stable-ish in the blood is also a really hard thing to
| do. They have to get to the right places (in this baby's
| case, the liver) and then degrade there, drop off the
| mRNA, and not mess up other tissues all that much. Like,
| it's not terrible to make these micelles degrade _in
| vivo_ , but to have them do that _and_ not degrade in the
| tubes, ... wow... that is _really_ difficult. There 's a
| reason that Moderna is so highly valued, and it's these
| bubbles.
|
| To try to then put these in a weapon that could do this
| though the airways would be, like, nearly impossible.
| Like, as in I think the second law of thermodynamics, let
| alone biology, and then simple industrial countermeasure
| like a N95 respirator, yeah, I think all of that makes it
| pretty much impossible to weaponize.
|
| (Hedging my bets here: I don't know if they had to do all
| that with this baby, as you can kinda go from lab to baby
| really fast, since it's such a special case. But for mRNA
| based vaccines and cancer treatments, you have to deal
| with the shelf stable issue)
|
| (Also, other bio people, yes, I am trying to explain to
| laymen here. Please chime in and tell me how I'm wrong
| here)
| okayishdefaults wrote:
| I think it doesn't need to be a direct weapon to be used
| in warfare. You can genetically modify your own military.
| Muromec wrote:
| That would be less effective than bio and chemical
| weapons are. Which are not used because they just suck
| Balgair wrote:
| Yeah, it's not a drama.
|
| The reason that the body doesn't alarm as much to
| Pseudouridine, is that it's not a 'natural' RNA base.
| Meaning that, for the most part, nature really never uses
| it and so we haven't evolved to look out for it. Nature
| uses Uridine and so immune systems have evolved to look out
| for random bits of RNA in the body that use it and then
| clean that all up.
|
| It's like if you're looking to clean up legos in you house
| with a romba that only cleans up legos. And all of a sudden
| it finds a duplo. It's going to take a hot second to figure
| out what to do with the duplo. And in that time, you can
| sneak by and build a duplo fort. (Look, I know this analogy
| is bad, but it's the best I can come up with on the fly,
| sorry. If anyone else wnats to come up with a better one,
| please do!).
|
| The Pseudouridine is used up and degraded very quickly
| inside the cell, minutes at the very very longest, more
| like microseconds. It's just part of a messenger (the 'm'
| in 'mRNA') to tell the cell to do things.
|
| You might see mRNA gene editing in factory farms, but it
| would just be easier to do germline editing instead and
| skip spraying animals, plants, and fungi. Why waste the
| equipment, right?
| abracadaniel wrote:
| As I understand it, there is nothing in nature that can
| create it, so the mRNA can never be accidentally
| replicated. It's a safety mechanism that prevents escape.
| monkeycantype wrote:
| I remember from a few few years back that the lipid coating
| may have caused problems for the liver, when treating people
| for diseases that needed to target a lot of tissue, such as
| muscle disorders. Is that still the case?
| shadowgovt wrote:
| Gene therapies are pretty incredible. Some of them are still
| making a button-hole with a machete, but that's relative to the
| previous medical intervention of a button-hole with a tank's
| main gun.
|
| One of the treatments for sickle-cell involves switching off
| the gene that makes the malfunctioning red blood cells, but of
| course that's not sufficient; you'd stop making red blood cells
| completely and you'd die. So it's combined with a modification
| that switches _on_ a gene that all humans express pre-birth
| that causes your body to make "super-blood": red blood cells
| with significantly more binding points for oxygen. This is
| necessary because a fetus gets oxygen from its mother's blood,
| so the increased binding affinity is useful for pulling the
| oxygen towards the fetus at the placental interface. After
| birth, expression of that gene is disabled and regular RBC
| genes switch on.
|
| So the therapy doesn't "fix" sickle RBCs; it disables the
| body's ability to make them and re-enables fetal RBCs! I have
| seen no literature on whether having fetal RBCs in adulthood
| has any benefits or drawbacks (besides changing the affinity
| ratio for their fetus if the patient gets pregnant, I imagine
| increased-affinity RBC could help for athletics... But I also
| imagine it requires more iron to generate them so has dietary
| impact).
| nomadpenguin wrote:
| High affinity RBCs would actually be a disadvantage for
| athletics. You actually don't need very high affinity to pick
| up oxygen from the lungs -- your lungs are comparatively
| extremely high in oxygen. What matters more is being able to
| drop the oxygen off in peripheral tissues. Higher affinity
| means that it's harder to actually deliver the oxygen, which
| is why we evolutionarily developed the switch away from fetal
| hemoglobin.
| jjtheblunt wrote:
| > That is one of the most incredible things I have ever read.
|
| This is even more great reading behind the above:
|
| https://en.wikipedia.org/wiki/Jennifer_Doudna
| bengale wrote:
| Walter Isaacson's book "The Code Breaker" is about this
| subject. I couldn't put it down.
| ascorbic wrote:
| A rare case where the list of awards she's received is so
| long it needs a separate Wikipedia page https://en.wikipedia.
| org/wiki/List_of_awards_and_honors_rece...
| pavlov wrote:
| If she were a federal employee, the current administration
| would label her a DEI hire and try to delete this page.
| They did it to Black veterans with extraordinary
| achievements.
| blangk wrote:
| This seems like a non sequitur.
| fsndz wrote:
| Never bet against science !
| znpy wrote:
| Yep, this is truly incredible!
| ac29 wrote:
| > To accomplish that feat, the treatment is wrapped in fatty
| lipid molecules to protect it from degradation in the blood on
| its way to the liver, where the edit will be made. Inside the
| lipids are instructions that command the cells to produce an
| enzyme that edits the gene.
|
| This isnt entirely unlike the method mRNA vaccines use. Through
| some clever biochemistry, mRNA vaccines get bits of code into
| cells where the cell's built in code compilers manufacture
| proteins that induce immunity.
|
| We have developed software patches for our biology.
| forgotpwagain wrote:
| Detailed New England Journal of Medicine article about this case:
| https://www.nejm.org/doi/full/10.1056/NEJMoa2504747
|
| And an Editorial piece (more technical than the NYT):
| https://www.nejm.org/doi/full/10.1056/NEJMe2505721
| caycep wrote:
| thanks for this, I think all these lay articles on biomedical
| news should definitely be accompanied by the paper
| bookofjoe wrote:
| I always try but way more often than not the paper is
| paywalled.
| ufmace wrote:
| Did you mean to post the same link for both?
| vessenes wrote:
| NYT isn't super specific here, but they made it sound like the
| disease treated is liver related. My understanding is that the
| liver is a good place to start with CRISPR-type gene treatments,
| in that the liver normally deals with anomalous shit in your
| bloodstream, say, like CRISPR type edits. So anywhere outside the
| liver is going to be significantly harder to get really broad
| uptake of gene edits.
|
| It's crazy encouraging that this worked out for this kid, and I'm
| somewhat shocked this treatment was approved in the US - I don't
| think of us as very aggressive in areas like this. But to me,
| really hopeful and interesting.
| scotty79 wrote:
| I don't think it's gonna be that hard. All cells that blood
| reaches were happily taking mRNA vaccine.
| derektank wrote:
| I hate to break it to you, but it will be substantially more
| difficult to target other organ systems. The liver is
| uniquely easy to target with our current vectors.
|
| Right off the bat, the liver receives roughly a quarter of
| all cardiac output, either directly or second hand from the
| digestive organs. Additionally, the liver has a fenestrated
| endothelium which, while not completely unique in the body,
| uniquely allows molecules like lipid nanoparticles (LNPs) to
| access liver cells. Finally, the liver is the site of most
| lipoprotein processing, and LNPs can be designed to take
| advantage of the existing pathways to get the gene editing
| mRNA into the hepatocytes. All this is to say that if you
| have a genetic condition that primarily effects the liver,
| there's a lot more hope for treatment in the near term than
| for others.
|
| Good lecture on the difficulties of finding appropriate
| platforms for delivering gene therapies to cells for anyone
| interested [1]
|
| [1] https://youtu.be/6URTjoK58Yc
| XorNot wrote:
| No they were not. A vaccine triggers an immune response, not
| a functional change.
|
| mRNA vaccines are highly localized: you get a sore arm
| because most of it only gets taken up by muscle cells around
| the injection site, which spend some time producing the
| antigen and triggering a primary immune response (the
| inflammation aka the sore arm).
| oceansky wrote:
| It is caused by a missing enzyme in the liver, yes.
| anarticle wrote:
| Specifically it is this:
| https://en.wikipedia.org/wiki/Carbamoyl_phosphate_synthetase...
|
| People born with this lack the enzyme CPS1, which screws up the
| urea cycle and causes a build up of ammonia. Ammonia build up
| is bad for your nervous system.
| cdcox wrote:
| You are right, current CRISPR systems tends to accumulate in
| the liver. Most CRISPR companies have shifted their focus to
| the liver over time because it's easiest to deliver there. Most
| viruses people use to target other organs are not large enough
| to carry CRISPR and lipid nanoparticles with CRISPR seem to
| like ending up in the liver and are hard to deliver at dose to
| hit other organ systems. It has been one of the big struggles
| of CRISPR companies. That being said, this is a huge deal and
| very encouraging.
|
| As to the FDA stance, it tends to be more willing to go ahead
| with compassionate uses like this when it's clearly life or
| death.[1]
|
| [1] https://www.statnews.com/2025/05/15/crispr-gene-editing-
| land... This discuss a little of the FDA stuff but not much
| more detail, it sounds like they did let them skip some
| testing.
| morkalork wrote:
| I think it was here a few years ago that I read a comment saying
| that sick children will be the Trojan horse for normalizing gene
| editing of humans, because who could say no to sick children,
| right? Well, guess it's here now, so how long utill the eugenics
| wars start?
| ninetyninenine wrote:
| [flagged]
| psychoslave wrote:
| [flagged]
| NoMoreNicksLeft wrote:
| [flagged]
| ninetyninenine wrote:
| A baby Hitler gaurantees a future with a grown up Hitler.
| Killing the baby eliminates that future.
|
| There could be other babies that can also grow up to be
| future Hitlers. So let's say 4 such babies exist. By
| killing one I eliminated 1/4 for futures with Grown up
| Hitlers that exist.
|
| This whole thread is getting flagged. Likely by an
| irrational parent who can't even compute natural selection,
| babe, and Hitler all in a single paragraph.
| mckn1ght wrote:
| I think part of the problem is that "really good" and "really
| bad" are not universally accepted norms for any given ethical
| question. What you're seeing is your own value system
| assumptions being checked.
|
| It's perfectly reasonable to say that while a technology has
| the propensity to be used for evil, it also has positive
| applications and that the real benefit now outweighs the
| potential downside in a hypothetical future.
|
| Otherwise you will go down a rabbit hole at the bottom of
| which lies a future where we all just kinda dig in the dirt
| with our hands until we die because every technological
| innovation can be used in a variety of ways.
|
| Like, it's silly to me that I can't bring a 1.5" blade
| keychain utility knife on a flight, and then they hand me a
| metal butter knife in first class. I could do way more damage
| with that. But they allow the butter knife because the
| utility has shown to far outweigh the potential downside that
| hasn't manifested.
|
| > I will slaughter a baby if I know for a fact that baby will
| grow up to be the next Hitler
|
| This is one of those things that is easy to say precisely due
| to the impossibility of it ever actually becoming a real
| decision you have to make.
| ninetyninenine wrote:
| >This is one of those things that is easy to say precisely
| due to the impossibility of it ever actually becoming a
| real decision you have to make.
|
| It's true. But things like this should be easy to say
| right? Like we may not be able to act logically. But we
| should be able to think logically, communicate logically
| and show that we are aware of what is logical.
|
| My post got flagged meaning a lot of people can't separate
| the two things. So for example I may not be able to kill
| the baby in reality, but I can at least see how irrational
| I am.
|
| The person who flagged me likely not only can't kill the
| baby. He has to construct an artificial reality to justify
| why he can't kill the baby and why his decision must be
| rational.
| cooper_ganglia wrote:
| The anti-eugenics guy just said he would "absolutely" murder
| a baby...?
| ninetyninenine wrote:
| I would if I can foresee the future. But with eugenics you
| can't foresee the future. Self artificially selecting for
| genetic traits doesn't guarantee a good future. There's no
| gene for recreating Hitler either.
| dekhn wrote:
| it's unclear the outcome of this will be eugenics wars.
|
| Answering the real question- it's unlikely these techniques
| will see widespread "recreational" usage any time soon, as they
| come with a wide range of risks. Further, the scientific
| community has learned a lot from previous eugenics programs;
| anything that happens in the future will happen with both
| social and political regulation.
|
| It's ultimately hard to predict- many science fiction writers
| have speculated about this for some time, and social opinion
| can change quickly when people see new developments.
| NoMoreNicksLeft wrote:
| The problem won't be that there will be those who want to
| have babies with edited genomes, and those who oppose that.
|
| It will be that people just don't have children at all.
| morkalork wrote:
| That's part of why the trojan horse works so well, what is an
| unacceptable risk for someone healthy can easily be
| acceptable for someone with an otherwise untreatable
| condition. Then by the experience and knowledge gained, it
| becomes less risky for everyone.
| jjcob wrote:
| It's not a slippery slope. Fixing defects is rather
| straightforward, since it's usually a single gene that needs to
| be edited.
|
| If you want make your baby smarter, taller, or more handsome,
| it's not so easy because these traits involve 1000s of genes.
|
| For this reason I do not think that curying diseases will lead
| to designer babies.
| GenshoTikamura wrote:
| You're certaily unfamiliar with the term "incrementalism" and
| its workings
| sfink wrote:
| If you can affect germline cells, then I don't see how it's
| not a slippery slope. (I'm not arguing against doing it, just
| that it is a slope and the slope is slippery.) No designer
| babies necessary.
|
| I'll steelman "fixing defects" by sticking to serious
| hereditary diseases (and yes, only those that correspond to
| one or a few known genes). As more and more conditions become
| treatable, the population with access to resources will have
| lower healthcare costs by being less susceptible to problems.
| (Which is a good thing, note!) Insurance companies will have
| more and more proxies for differentiating that don't involve
| direct genetic information. Societally, "those people" [the
| poor and therefore untreated] cost more to support medically
| and are an increasing burden on the system. Eugenics gains a
| scientific basis. Do you want your daughter marrying someone
| genetically substandard, if you don't have the resources to
| correct any issues that might show up? Probably not, you're
| more likely to want to build a wall between you and them.
| Then throw over anyone who falls behind the bleeding edge of
| corrections.
|
| It'll be the latest form of redlining, but this time "red"
| refers literally to blood.
| ysofunny wrote:
| I think i'm fighting on those wars right now, you can also call
| them 'darwin wars' i suppose... but bear in mind i'm crazy and
| online
| ecshafer wrote:
| As a father, the idea of being told my 1 week old baby is going
| to die would be my worst nightmare. The fact these doctors and
| scientists saved this childs life is a monument to modern medical
| science. This is absolutely insane. Hopefully the child doesnt
| need a liver transplant, but this is a great leap forward.
| efilife wrote:
| But your child _will_ die and that 's a fact. Is it only ok to
| die after you?
| frankfrank13 wrote:
| bro read the room
| foxglacier wrote:
| If you're being pedantic, babies usually never die - they
| transform into an adult which is the form that dies.
| blacksmith_tb wrote:
| Typically yes? But surviving infancy is the first step on the
| road to immortality (but that will require more than
| CRISPR... probably?)
| 331c8c71 wrote:
| Immortality? (rolleyes)
| bigs wrote:
| Hopefully after living a long and fulfilling life? Geez
| morepedantic wrote:
| Edgy! No one has ever considered the mortality of their
| children ever, or contemplated the difference between death
| before and after the realization of potential. Wow!
| javiramos wrote:
| Research funded by the NIH which our government is actively
| gutting
| jmcgough wrote:
| Yep, this effort is the culmination of 50 years of research.
| Could be the last harrah of the NIH with the amount of cuts
| we've had and the scientists who are taking jobs in other
| countries.
| declan_roberts wrote:
| Unfortunately a staggering amount of research in other
| countries is largely funded by the NIH/USA.
| thrance wrote:
| How so?
| jordanpg wrote:
| And so what?
| lenerdenator wrote:
| That means that it's not going to happen anymore.
|
| Unless those other countries step up and fund it
| themselves.
|
| They might. They might not.
| julienchastang wrote:
| Not to mention the long arcs of the careers of scientists and
| support staff involved in this breakthrough, who were also
| supported by federally funded research grants.
| dylan604 wrote:
| Interesting view as many people were so anti-MRNA vaccine
| because "it was created too fast" oblivious to the
| years/decades of study in that field that allowed for that
| "too fast" to happen.
|
| I guess it's still too early in this story's news cycle for
| the people with anti-views to be making noise yet. No GMOs,
| but human gene modification is okay. No cloning either. The
| boogeyman is gonna get us no matter what we do
| thrance wrote:
| The Secretary of Health and Human Services is a conspiracist
| that doesn't believe in vaccines and swims in sewers with his
| toddler to prove a point about "natural immunity" [1]. The new
| Surgeon General prayed to the stars and the trees and took
| mushrooms to "get ready for partnership" [2]. This is the party
| of so-called "rationalists".
|
| Fascism has a long history of rejecting rationalism and
| science, and of embrassing esotericism [3]. Something our
| representation of nazis in media did a terrible job at
| conveying. We always see nazis as cold, calculating and
| rational when they are anything but.
|
| [1] https://www.nytimes.com/2025/05/12/us/politics/rfk-jr-
| rock-c...
|
| [2] https://www.pbs.org/newshour/health/trumps-new-surgeon-
| gener...
|
| [3] https://en.wikipedia.org/wiki/Occultism_in_Nazism
| jordanpg wrote:
| As the father of a 5 year old boy with a genetic degenerative
| muscular disease whose lifespan will depend directly on how
| fast these technologies progress, I have difficulty responding
| in a civilized manner to the pointless, cruel, and stupid
| actions of the Administration in this regard. Rage is the word.
|
| It is breathtaking to consider how the members of the
| Administration and their children, parents, and grandparents
| have benefited from NIH-funded research in innumerable ways
| that they are shamefully unaware of, every time they visit the
| doctor or the ER.
| epistasis wrote:
| I have the same rage. But it extends equally to those who
| voted them in and donated to their campaigns, including my
| own family members.
|
| They have created a huge rift in this country and I am still
| trying to figure out if I will forgive my family members and
| what they'd have to do to set us on a path towards
| reconciliation.
|
| When there's a contract in place to conduct pediatric cancer
| research, and the government decides one day to break that
| contract, and it takes courts to rectify the situation, and
| then the government defies the courts, and the voters are
| cheering on the illegal actions of the politicians, well,
| rage is a mild word for what I feel.
| throw7 wrote:
| Gattaca here we come!
| GenshoTikamura wrote:
| One can not simply raise valid concerns about gene editing
| technologies in the hands of the entities that don't hesitate
| sending people en masse to kill and die and otherwise manifest
| their fascist cravings in the open, here on HN and walk away
| undownvoted
| sfink wrote:
| There is a strong hunger for Gattaca.
|
| Heck, if parents could provide a trust fund for their kids in a
| way that their kids couldn't piss it away, they'd be all over
| it. (I'm sure this exists to varying degrees.)
|
| Look at what wealthy parents already do to get their kids into
| colleges or out of jail. I think it's ridiculously naive to
| think that we parents wouldn't jump at the chance to write
| generational wealth into our kids' genes.
|
| (This is not an argument that developing this capability is a
| bad thing and should be stopped.)
| Traubenfuchs wrote:
| Are the edited genes inherited, or the original ones? Does the
| previous question have an answer that depends on the babies sex?
|
| From an evolutionary perspective it's interesting how the further
| medicine gets, the more we inherit genes unfit for life without
| medical support.
| breakyerself wrote:
| I'm sure we'll be editing these diseases out of the germ line
| at the same time in the not too distant future.
| EvanAnderson wrote:
| Speaking as a person whose friend died at 21 from
| complications related to cystic fibrosis I would like to see
| these diseases edited out of the germ line.
| Balgair wrote:
| No, it's only in the liver, from what I can tell from the
| science, not the gametes.
|
| No, it would not depend on the sex of the baby, as the
| chromosomes that you're editing aren't X or Y.
|
| Evolutionarily, the inheritance of genes is a far slower
| process than the medical advancements we make, so what I think
| we're seeing here is a chasing down of the low probability
| events. In that, most of the evolutionary pressure is coming
| from things like dirty water and bad food, but as we're solving
| those low hanging fruit, we have to go to lower probability
| events to make progress that feels equally important.
|
| Also, if I am wrong here on the answers to the questions,
| please correct me!
| dekhn wrote:
| If they could get complete delivery to the liver stem cells,
| then the change could be permanent, although this is making
| many simplifications.
|
| Organs in your body usually keep some very old cells (formed
| in the embryo) around which act as parents for all the new
| cells in an organ. Any cell can only divide a limited number
| of times, so they typically maintain a "tree structure" where
| the old cells create children and grandchildren (etc) that
| then differentiate into the organ-specific cells that do the
| actual organ work.
|
| If you modify only the differentiated cells, eventually they
| die, and are replaced by descendents of stem cells; if those
| stem cells didn't get modified, their descendents will not
| have the fix, and the treatment efficacy reduces over time.
| thrance wrote:
| Is the global gene pool actually degrading though? I only ever
| hear that in thinly veiled attempts at advocating for
| eugenicism. And it never comes substantiated by any research.
|
| Anyway, this baby proves we can fix hereditary diseases now.
| lawlessone wrote:
| couldn't be unless they reached reproductive cells.
| bilekas wrote:
| > But KJ's treatment -- which built on decades of federally
| funded research -- offers a new path for companies to develop
| personalized treatments without going through years of expensive
| development and testing.
|
| Really incredible story and I'd love to know the process for
| receiving this, for example FDA approval etc. It's nice to see
| such in-your-face results from Federal funding programs. Without
| being political, it's sometimes hard for regular people to
| appreciate just how much good actually comes out of Federal
| Funding. There was another thread where someone even said
| something along the lines of : "Well during war things get done
| faster" . This simply isn't true. It might be done louder but
| Federal Funding never stopped pushing things forward.
| baxtr wrote:
| Now imagine DOGE team of experts cutting this a couple of years
| ago
| bilekas wrote:
| I didn't want to bring up specifics but I'd be lying if it
| wasn't on my mind.
| shadowgovt wrote:
| It would probably be good if more of us brought up
| specifics more often.
| 0_____0 wrote:
| Here's the thing - likely few would have noticed. We are
| structurally blind to the places in which public investment
| would have made our lives better, especially when they are
| things like scientific research that the vast majority never
| think about until it produces results.
| jjeaff wrote:
| I'm not an expert, but I have learned that FDA approval is not
| actually necessary for treatments and drugs. Your doctor has a
| lot of leeway when it comes to treatment but she of course
| experiences more risk of accusations of malpractice when
| prescribing off label drugs or unapproved treatments. insurance
| will also rarely cover treatment that is not FDA approved. the
| requirement for FDA approval generally has more to do with your
| legal ability to market the drug, treatment, or product.
| foxglacier wrote:
| I wonder if this also affects germline cells so he won't pass the
| same disease on to his children. If it does, that would be a
| complete departure from almost all medical treatments we use
| because most of them are just compensating for the effects of bad
| genes and leaving them in the gene pool to degrade the health of
| future generations.
| thomasjudge wrote:
| Can you imagine the emotional rollercoaster of this for the
| parents
___________________________________________________________________
(page generated 2025-05-15 23:00 UTC)