https://www.meme.net.au/nkrypt/ NKRYPT sculpture photograph of installation area NKRYPT is a cryptography related installation outside the Questacon science exploration centre in Canberra, Australia. It was designed by Stuart Kohlhagen, and installed in March 2013 during the Centenary of Canberra These pages document progress towards deciphering this work. There are many parts which have yet to be publicly solved. Other NKRYPT related pages include dkrypt.org with extensive photographs, entries on Klaus Schmeh's blog and the facebook page. * plaque * overview * geospatial and caesar * semaphore and scytale * binary and rotor * pigpen and cogs * braille and railfence * dna and astroids * squircles and waveform * labyrinth and title and pvl * base code * tweet spoilers [hide] plaque A plaque on the wall of the forecourt near pillar H introduces the installation. NKRYPT Mystery beyond Decipher the veiled meaning Renown awaits you From simple to hard, the key to the last is found in all the rest. One code within NKRYPT celebrates Canberra's Centenary. Be first to decipher it and win a great prize. For more information: www.questacon.edu.au Proudly supported by Mr Eddie Kutner and Mr Leon Kemplar overview NKRYPT consists of eight stainless steel pillars. Each pillar has several stenciled ciphertexts which have been lasercut out of the steel. They are lit both externally and internally. The pillars each have a cipher at about head height, and these can all be represented as a cylinder of 26x5 symbols, which I call the 'ring' ciphers. The lower half of each of the pillars also have a cipher, varying widely in form. Across the bases of the pillars is another cipher. And the tallest pillar has a cipher in the section above the ring cipher. I have arranged the pillars in order of fiducial spacing, which I have labelled A to H. On other websites you will find a numbering scheme; the correspondence is A=7, B=4, C=6, D=2, E=8, F=3, G=5, H=1. Pillar heights are A=1709mm, B=1887mm, C=2153mm, D=2347mm, E=2393mm, F=2379mm, G=2432mm, H=2569mm. montage with all eight pillars Above each ring cipher is a pair of triangular fiducials, one immediately above and a second at the top of the piller. They face A= south, B=north, C=north, D=south, E=east, F=west, G=east, H=west. The triangular fiducials are in pairs on the pillars, with separations of A=0mm, B=116mm, C=354mm, D=571mm, E=628mm, F=636mm, G=655mm, H=786mm. All of the ring ciphers are traversed in labyrinthine fashion. Between each pair of rows, there is only one traversal down and up, and we think that these traversal positions represent settings for the rotor machine on pole C (A=DNOI, B=CFEC, C=FHIG, D=HWCJ, E=EFCF, F=CMBH, G=????, H=SMOU). The end of the ring ciphers is the symbol below the fiducial (pillars A, B, D, H), or 180 degrees from that position (pillars C, E, F). They start and end on the top row (pillars A, B, C, E, F, H), or the bottom row (pillar D). The pillars are placed on the west side of Questacon, and form a constellation as shown in this scale diagram. aerial photograph of nkrypt layout of the pillars A: geospatial [geospatial] 35248614916353547101490974 24725391509414892533731941 14909573522681490367353636 41635353213194116435346709 81491040353180149092635377 A sequence of numbers which are latitude and longitude coordinates for locations around Canberra. The first three suburbs are Questacon locations, and the remaining suburbs are connected to Australian scientists and innovators. This was the solution to the Centenary Code challenge. 35248614916353547101490974 24725391509414892533731941 14909573522681490367353636 41635353213194116435346709 81491040353180149092635377 35.2742S, 149.1373E Ainslie, former location of Questacon 35.2984S, 149.1312E Parkes, Questacon National Science and Technology Centre 35.3180S, 149.0926E Deakin, Questacon Technology Learning Centre 35.3778S, 149.1040E Farrer [wheat breeding pioneer] 35.3536S, 149.0764E Chifley [streets named after scientists] 35.3461S, 149.0367E Rivett [chemist] 35.3636S, 149.0957E Mawson [Antarctic explorer] 35.2268S, 149.0519E Florey [pharmacologist and pathologist] 35.2486S, 149.1635E Hackett [streets named after scientists] 35.4710S, 149.0974E Banks [botanist] [plaintext posted by Glenn McIntosh] A: caesar [caesar] A LETTER SHIFT A CIPHER MAKES A FAMOUS ROMANS NAME IT TAKES B MFUUFS TIJGU B DJQIFS NBLFT B GBNPVT SPNBOT OBNF JU UBLFT C UJKHV QH VYQ AQW PQY ECP DTGCM DWV QVJGT OQXGU C EQFG ECP OCMG KRZHYHU WKHB EH VZDSSHG DERXW D NXID PDQ FRXOG ILQG WKHP RXW RPKR QMWJZZKRG WYMABY INGY PZBZIE XROZA OPK RNQV SA ENMPL XVZIZ GBHV ERIQIF These are various kinds of shift ciphers, Caesar cipher, shift cipher, Al-Kindi cipher, and Vigenere cipher. The last Vigenere cipher uses the keyword "VIGENERE". A letter shift a cipher makes a famous Roman's name it takes [Caesar] A shift of two you now can break but other moves a code can make [shift] However they be swapped about a Kufa man could find them out [Al-Kindi] When different shifts each letter takes The name of which great code awakes [Vignere] [plaintext posted by Gregory Lloyd] B: semaphore [semaphore] 65 45 32 33 42 46 64 64 21 66 46 32 34 64 51 42 31 12 66 33 43 65 33 66 11 51 64 12 64 64 33 42 33 66 32 55 66 41 46 45 33 13 12 64 56 45 34 13 26 66 36 26 45 51 64 64 36 51 66 46 64 51 51 66 41 64 32 34 66 42 31 13 45 33 66 34 34 26 12 64 45 31 26 51 11 66 33 12 12 31 66 51 11 42 33 12 31 42 64 46 42 26 55 11 45 24 56 12 64 46 66 31 12 51 66 51 26 33 45 31 41 64 33 43 64 55 42 46 32 33 This is a Chappe semaphore system, transcribed with a number representing the angle from the centre of the glyph (45, 90, 135, 225, 270, 315). COPRIMEEXAMPLESINDARKCRABS EDEERIRAPYAGMORFDEWOLFTAHT OSEEHSAMESSAGEPLAINFORALLT DEONTSBARDDNASBIRDNIEMITYB OVWDEMANDSASTRONGERKEYIMPR code that flowed from gay Paris a message plain for all to see now demands a stronger key improved by time in dribs and drabs three prime examples in dark crabs [plaintext posted by Bob Dovenberg] B: scytale [scytale] AGPSHALHALIECNREWTOCTPUWS MEOLOLOADOEEEOSAAHVHEERIP EHNAWLSVMFNCRFICCAESRDENA SIHVNBEEIATETAAEOTDMHEHFR SDIETYRARNGUAPNSDPMAENIOT AUSSOCSNACRNIEPAERURLSSRA This is a scytale wrapped around a hexagonal baton. The plaintext refers to a message of revolt marked on the head of a slave by Histiaeus, and a scytale scroll sent to Lysander of Sparta in 404BC. A message hid upon his slave shown to all by closer shave an admiral of ancient Greece uncertain of a Persian peace saw a code that proved much smarter helped ensure his win for Sparta [plaintext posted by 'skintigh'] C: binary [binary] -...-.....-.-...--..--.--..-.--..-..-..-.--.-..----. --...------...-...-.-----.......----.-......-.--.... ..-...........-.-.-.........-.......-...-...-....... ----------..---.-...-..--..-.--.-...-..--.---.-...-. .-----..--.--..-..-.......-......--.....-.-----.-.-. ............-.-.......-.....-...-.....-.-........... -...---..--..----..-----..-..----.--.-..-.--..-..--. .----.-...-...-..----...-.-...-.-.-----.-...--..-... ....-.......-.........-.-.-.-.........-...-.....-... --.-.--.....-.-..--.-.-.-.------.--.....-...----...- ---...-..--.-.....-.-----.--..-.--.-----.-.-....-... ....-.....-.-...-...........-.................-...-. --.----..--.----..-..-.--...-..-...--.-..-----.--.-. --....-...-......--.--...-.--...-..---......----.--- ..-.-...-.-.-.-.......-.-.....-.-.-.....-........... This is a binary code with dashes for 1 and dots for 0. Each character is a 2x3 array, with the bits low order first. The plaintext is a list of scientists and inventors, who worked on electrical telegraphy and wireless telegraphy. MPILLEATSTONEBRANLYBRAUNCA KOOCOHWYADARAFRAYDARUOMEDE ILWEBERGINGSTURGEONTESLAVA OFREHTUAREMMEOSGNILLIHCSDR ORSERUSSHENRYHERTZMARCONIM Branly, Braun, Campillo, Cooke, DeMoura, Dyar, Faraday, Gauss, Henry, Hertz, Marconi, Morse, Rutherford, Schilling, Soemmering, Sturgeon, Tesla, Vail, Weber, Wheatstone [plaintext posted by Glenn McIntosh] C: rotor [enigma] diagram of rotor connections Rotor 1 wiring ABCDEFGHIJKLMNOPQRSTUVWXYZ UDBCFGEJHILMKTSNOPQRWXYZAV Rotor 2 wiring ABCDEFGHIJKLMNOPQRSTUVWXYZ BZCXWHIFGLMJKVUPSQRTONEDYA Rotor 3 wiring ABCDEFGHIJKLMNOPQRSTUVWXYZ ZADEFGCHMIJKLOPQRNWSTUVBXY Rotor 4 wiring ABCDEFGHIJKLMNOPQRSTUVWXYZ BDFCEGIJKLSMAZNHOPQRTVXUWY Reflector wiring ABCDEFGHIJKLMNOPQRSTUVWXYZ ZYVMLIHGFKJEDURQPOTSNCXWBA BIOB AXQC NLPA MNXE SBNT FJLD DL JAWS FDHD MATX EJHM PVUJ XJOM KH These are movable rotor wheels with wiring lines between letters (analogous to an Enigma machine). The reflector wheel is fixed. Each have triangular fiducials for alignment of the start position. The advancement is done manually, with a sequence chosen by the user. It is possible that the lower ciphertext is some sort of transposition key. Here is a C++ implementation of the encryption. [unsolved] D: pigpen [pigpen] LUCKVERURCHSIEGINGALLMEING IENEROLDRIMTELHEFRETHCSOBN HTUSERKORENDENNMEINETOEWIC NEAHCINIBESHCONRHITIMHOLFT ZUMLEIDENHICHSIEZITTERN123 This is a pigpen cipher, with right-to-left lines upside down, and in German. The plaintext is the second quatrain from the first aria performed by the Queen of the Night in Mozart's "Die Zauberflote". The pigpen cipher was commonly used by the Freemasons, and the opera contains rationalist Freemason motifs. LUCKVERURCHSIEGINGALLMEING IENEROLDRIMTELHEFRETHCSOBN HTUSERKORENDENNMEINETOEWIC NEAHCINIBESHCONRHITIMHOLFT ZUMLEIDENHICHSIEZITTERN123 Zum Leiden bin ich auserkoren Denn meine Tochter fehlet mir; Durch sie ging all mein Gluck verloren Ein Bosewicht entfloh mit ihr Noch seh ich sie zittern. 1 2 3 I am chosen for suffering, for my daughter is gone from me; Through her all my happiness has been lost, a villain fled with her I can still see her trembling 1 2 3 [plaintext posted by Bob Dovenberg] Conjecture, the '123' filler at the end of the plaintext might refer to: the three remaining lines of the third quatrain (Erschuttern, Beben, Streben); the three flats of the key; the three chords beginning the overture (E-flat minor, C-minor, E-flat major); the three masonic pillars (wisdom, strength, beauty); or the three veiled ladies who attend the queen of the night. D: cogs [cogs] diagram of cogs placement [cogs] [unsolved] E: braille [braille] ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** ** This is a Braille cipher. Lines traversed right-to-left are upside down. GENEADOFANAILASHORTSIGHTED WLARERFDLONAKRAPOTSESUBHTI EIHEHENCHBARBERSITTINGQUIT TNTNOILGREGNIFAFOPITKRADEH WORKSDEOFASNAILALLOURGREAT A short-sighted general with buses to park [Napoleon?] an old French Barber sitting quite in the dark [Barbier] Tip of a finger, glide of a snail [Braille] all our great works on the head of a nail. [plaintext posted by Bob Dovenberg] E: railfence [railfence] The lower cipher is a rail fence cipher. A simple code to hide your tails it's letters nailed to different rails [rail fence cipher] A famous scholar from times past with copper discs encoded fast [Alberti] A German monk with codes so strong used keys to shift the cipher on [Trithemius] A family down the mountainside a cabinet noir they worked inside [Rossignol] [plaintext posted by Matthew Bienik] F: dna [dna] AGGTAGTTGCTC*AAGCGTGCTAGCT TCCATCAACGAG TTCGCACGATCGA GGGTACGGTCCACCAGGAGGCATACT CCCATGCCAGGTGGTCCTCCGTATGA CCCTGTGCGTAAACCGTCTGATGACC GGGACACGCATTTGGCAGACTACTGG AAGGCACACGGCCGCTCATACGGTAG TTCCGTGTGCCGGCGAGTATGCCATC GTTAGTTACCTTGCGTGCTCTCGGCC CAATCAATGGAACGCACGAGAGCCGG These group in 3-letter codons for proteinogenic amino acids. The amino acids each have a 1 letter code. TCCATCAACGAG*TTCGCACGATCGA GGGTACGGTCCACCAGGAGGCATACT GGGACACGCATTTGGCAGACTACTGG AAGGCACACGGCCGCTCATACGGTAG CAATCAATGGAACGCACGAGAGCCGG TTC GCA CGA TCG ATC GGT CAT ACG GAG GAC CTG GCA GAC TAC TGG GAG ATG GCA TAC TCG CCG GCA TGG AAC GCA CGA GAG CCG GCA ATC AAC ACG GAG GAC ACG CAT TAC CTG GCA TGC ATC AAC GAG F A R S I G H T E D L A D Y W E M A Y S P A W N A R E P A I N T E D T H Y L A C I N E far sighted lady we may spawn a repainted thylacine [plaintext posted by Bob Dovenberg] Conjecture, the plaintext may refer to the Australian conservation geneticist Karen Firestone, who worked on the Australian Museum project to recover thylacine DNA. F: astroids [astroid] diagram of astroid placement The astroids are in 42 columns spaced around 22mm apart and with irregular vertical spacing. Each astroid is around 15mm across. They are the shape of the Unicode black four-pointed star (U+2726). [unsolved] Conjecture, they may represent light spectra (eg from stars or elements). G: squircles [squircle] diagram of squircle placement 01110011011101021231331012 02030013322303333000200032 21221133103032320102000132 23123002121223001301131123 10103100010101201201221103 30212131033000203011112330 30101111212032132012210133 13303323023120222333322012 00000101022001203231310031 30110333202120112302112123 [unsolved] These 'squircles', have an appearance like petals or cams. Conjecture, is that they are grouped in vertical pairs to give the standard 26x5 labyrinth grid. G: waveform [waveform] [waveform] UWGHTLIYCOEYDY RFKVOACMHPUCEAL BANYUJHEESHABPS NAYIDQGILTIVKTE FAESOKTMZQDMRGH HYLHNICNLBNWWXX KGAPYHIIQHSKETZ RRENUCMTVUINLZR ICYRFFGTKDNBQSH NLXZWKMVCICTCDD ZAOWRSUNVMDOIXG ZCCFCUEAKAKFSMP YRHUUTMCYSSMPFG TUCIESREQXAICHL LYVBKNNZVBPKNQA EXQSHOSGVZDHDFM HYPHCUDQTMWVNEK NGACBGTSACXEHRE DUUHNQVDATWTIEK ZRFHTOFRUPTKHNP XYNFBBHWPVSSKIN NOHYWLJQZKWRSQO UIEEQKYEMPRQEDM IVSVAPNGKDVPQME XGCIOAVXVIGTPIQ ORDQRJEKWFPVWZP ECYNYRCGWWIFCYX GVLGPLBSJGMIJCX RHYEOHHWTXOAGYS FSDOZGZJGNPTRUA ESTRPYFTJVZQHOP EQLOQRGPHPKEDEI IQHCZYWPJZKAZQA KSKMIPLDRGCWCAD GZCDBB This consists of 515 characters, split into lines mostly of 15 characters which are spaced and offset so they appear like the plane projection of a double helix. The start of each line is a sine wave with a frequency of about 0.75 radians per line, with the ending of each line lagging by a quarter circle. [unsolved] H: labyrinth ... [labyrinth] ALABYRINTHSTANDSBEHATAWAIT EHTHGUORHTPEOYEROFTSAMGINE ATONEBYONESTUATHEYCREATETH IEFOENOTUBSIDNSNRETTRAMTHG ETWISTSANDTURNSFORPAKALLTH ALABYRINTHSTANDSBEHATAWAIT EHTHGUORHTPEOYEROFTSAMGINE ATONEBYONESTUATHEYCREATETH IEFOENOTUBSIDNSNRETTRAMTHG ETWISTSANDTURNSFORPAKALLTH A labyrinth stands before you and is but one of eight Mark all the twists and turns for patterns they create That one by one step through the enigmas that await [plaintext posted by Glenn McIntosh] H: title [title] N K R Y P T NKRYPT H: PVL [pvl] Above the ring cipher is another cipher of 26x10 letters, and the letters 'P', 'V', and 'L' are in a larger font. OXPUWAOEKZVCRLUYFMLXTPNATW VGZTCGVGDAAXFDKOCRFRUOKAPW LCMPTFPBTYXRSZKKQUBJAMHYUL MZVSXXZHDLYHOKWWEJUXLXKRZU PPESLBOEKOGRTAYDFOHRHVMPBN DTEZBTYDXNMPXHVNKCIYEMJFVE MNKDIQBOSUFFFWBVDNKHRTLIMZ WRRQUFNNBGKUWNQCHDEFSTZZRQ UIUDPTKGATPSJIFXXGGSNTWJLA BRYVUCSBNPYAVSTTONZFWIUUNW [unsolved] Conjecture, this is perhaps the conclusion of the eight ring ciphers, and may require the information from those other ciphers to decode, for example the labyrinth alignment codes. base code A 10/11 9/11 9/12 13/17 28/29 15/17 11/12 11/12 11/13 20/24 9/13 11/ 11 7/9.3 11/11 14/17 B 10/10 9/12 11/13 15/17 28/30 17/18 11/12 8/10 14/15 22/24 12/13 11/ 12 7/10 8/11 14/17 C 10/10 11/12 11/13 14/15 30/30 17/18 12/12 8/10 14/14 19/22 12/12 11 /13 7/7 8/8 14/17 D 10/11 9/14 12/13 15/17 28/30 17/17 11/11 8/12 13/15 22/24 9/13 11/ 11 9.3/10 8/11 14/17 E 10/11 12/14 11/13 15/22 28/30 16/17 11/13 8/10 12/15 22/22 10/13 11 /13 9/10 8/8 16/17 F 10/12 12/14 11/12 14/15 28/30 16/17 11/11 8/10 10/15 19/24 9/12 11/ 13 9/9.3 8/8 14/17 G 11/12 9/12 11/13 15/17 28/30 17/18 11/11 10/12 13/14 19/24 12/13 11 /12 7/9.3 8/11 14/17 H 10/12 11/12 11/11 14/17 30/30 16/18 11/12 10/10 10/14 19/24 12/12 12/13 7/9 8/11 14/14 These appear to represent repeat counts from 15 autosomal-STR loci of DNA, used as forensic 'fingerprints' for human individuals. These are loci measured by systems such as the Powerplex 16 HS. The order is alphabetic (CSF1PO, D13S317, D16S539, D18S51, D21S11, D3S1358, D5S818, D7S820, D8S1179, FGA, PENTAD, PENTAE, TH01, TPOX, VWA). The genotypes here are similar, and probably from a European/Asian population group. [unsolved] Conjecture, is that these are genetic relationships. If so, the possible filial connections are A-D, B-C, B-D, B-E, B-H, C-H, D-E, D-F, D-G, F-H, G-H. If we require both parents, then the possible parental connections are AE-D, HD-F, HD-G, and either HD-B or HB-C. opening day tweet On the opening day, Senator Kate Lundy tweeted a message which had been encoded using the rotor cipher. A photograph taken then shows a rotor setting of CYWE. HDXJNFJXZJEZTHDBMMWQZJTUROGOUCRFRUOHHZMLQPMBKUYKKCRNKDLNDLXJNIDIHJIHQKWDPCI With a rotor setting of "SWYQ" (which is rot13 of "FJLD"), the last sixteen letters decode to "thecentenarycode". ??????????????????????????????????????????????????????????? thecentenarycode [unsolved]