From owner-biophysics@net.bio.net Wed Sep 09 23:00:00 1998 Path: biosci!news.stanford.edu!su-news-feed2.bbnplanet.com!su-news-hub1.bbnplanet.com!news.bbnplanet.com!logbridge.uoregon.edu!news.u.washington.edu!fujimoto From: fujimoto@u.washington.edu (Bryant Fujimoto) Newsgroups: bionet.biophysics Subject: Re: 3-D structure of DNA Date: 10 Sep 1998 19:58:25 GMT Organization: University of Washington Lines: 31 Message-ID: <6t9b11$16iq$1@nntp4.u.washington.edu> References: <1998090904052500.AAA18337@ladder01.news.aol.com> <35F64F16.485420EA@mrc-lmb.cam.ac.uk> NNTP-Posting-Host: homer18.u.washington.edu X-Trace: nntp4.u.washington.edu 905457505 39514 (None) 140.142.17.38 X-Complaints-To: help@cac.washington.edu NNTP-Posting-User: fujimoto Yu Wai Chen writes: >> You want to determine the 3-D structure of a 25 base pair oligonucleotide >> duplex. The sequence is: >> 5'TTTTTAAAAATTTTTGGGGGGGGGG3' >> 3'AAAAATTTTTAAAAACCCCCCCCCC5' >> >> A. Describe the kinds of secondary and tertiary DNA structues that youmight >> expect to find in the DNA. >> B. Propose a multi-approach experimental strategy for testing your hypotheses. >> Describe the kinds of information each approach would provide, andhow the >> approach could be used to confirm or discount your hypotheses. What could be >> the alternative outcomes and conclusions? >> >> I was considering making a flow chart of the approaches and possible outcomes >> We've been talking about the various microscopies, NMR and crystallography. >> I'm assuming we would use those methodologies. >For A, you need to thik about it yourself. This is the whole point of >your exercise. For B, I bet NMR will tell you everything. Now you need >to know why --- check your textbooks. Isn't this too long for an NMR structure? 25 basepairs, non-self complementary? Does anyone know what is the longest duplex DNA for which a structure has been determined? Bryant Fujimoto fujimoto@u.washington.edu -- Bryant Fujimoto fujimoto@u.washington.edu .