From owner-biophysics@net.bio.net Tue Sep 08 23:00:00 1998
Path: biosci!agate!newsfeed.berkeley.edu!news.maxwell.syr.edu!Cabal.CESspool!bofh.vszbr.cz!pegasus.csx.cam.ac.uk!not-for-mail
From: Yu Wai Chen <ywc@mrc-lmb.cam.ac.uk>
Newsgroups: bionet.biophysics
Subject: Re: 3-D structure of DNA
Date: Wed, 09 Sep 1998 10:49:10 +0100
Organization: MRC Centre for Protein Engineering
Lines: 26
Message-ID: <35F64F16.485420EA@mrc-lmb.cam.ac.uk>
References: <1998090904052500.AAA18337@ladder01.news.aol.com>
NNTP-Posting-Host: i11.mrc-lmb.cam.ac.uk
Mime-Version: 1.0
Content-Type: text/plain; charset=us-ascii
Content-Transfer-Encoding: 7bit
X-Mailer: Mozilla 4.05 [en] (X11; I; IRIX64 6.2 IP28)

> You want to determine the 3-D structure of a 25 base pair oligonucleotide
> duplex.  The sequence is:
> 5'TTTTTAAAAATTTTTGGGGGGGGGG3'
> 3'AAAAATTTTTAAAAACCCCCCCCCC5'
> 
> A.  Describe the kinds of secondary and tertiary DNA structues that youmight
> expect to find in the DNA.
> B.  Propose a multi-approach experimental strategy for testing your hypotheses.
>  Describe the kinds of information each approach would provide, andhow the
> approach could be used to confirm or discount your hypotheses.  What could be
> the alternative outcomes and conclusions?
> 
> I was considering making a flow chart of the approaches and possible outcomes.
> We've been talking about the various microscopies, NMR and crystallography.
> I'm assuming we would use those methodologies.

For A, you need to thik about it yourself.  This is the whole point of
your exercise.  For B, I bet NMR will tell you everything.  Now you need
to know why --- check your textbooks.

-- 
===================================================================
Yu Wai CHEN, Ph.D. ..................  email: ywc@mrc-lmb.cam.ac.uk
 Centre for Protein Engineering,              tel: 44-(1223) 402148
 MRC Centre, Cambridge  CB2 2QH, U.K.         fax: 44-(1223) 402140
 WWW homepage: http://www.mrc-cpe.cam.ac.uk/people/wai.html

.